https://disk.yandex.ru/d/r

напишите нам🌞🙏:

Клуб БРТ Биорезонанс 2026

https://vk.ru/brt_biorezonans

Нет ТГ? Пишите ВК https://vk.me/matricy.garyaev

https://t.me/Wave_Genetics

https://t.me/Petr_Garyaev

PCR Amplification of Phantom DNA Recorded as Potential Quantum Equivalent of Material DNA Peter P. Gariaev*

PCR Amplification of Phantom DNA Recorded as
Potential Quantum Equivalent of Material DNA
Peter P. Gariaev*
, Irene P. Vladychenskaya & Ekaterina A. Leonova-Gariaeva
Institute of Quantum Genetics LLC, Moscow, Russia
ABSTRACT
In this article, we describe the method and application of PCR amplification of phantom DNA
recorded using modulated secondary broadband electromagnetic radiation (MBER) of LHN-303
Laser as potential equivalent of material DNA. As examples, we report two experiments applying
the herein described method. We appeal to and invite other research groups to verify our method
and results independently.
Keywords: DNA, Phantom DNA, PCR amplification, electromagnetic radiation, audio recording.
I. Introduction
DNA Phantom Effect1
was discovered in our laboratory led by the author in 1984 using the
method of correlation laser spectroscopy. The first publication about this was in 1991 [1].
In 2001, we used DNA phantoms in Canada in the form of secondary radiation from a LGN-303
laser [2] for the transmission of a pool of active genetic information over a distance of 20 km. In
this experiment, pancreases of a few dozen Wistar rats were inactivated through alloxan induced
diabetes. These rats were subsequently treated with distant phantom genetic information read by
the laser from pancreases of newborn Wistar rats of the same genetic lineage. In the control
group, 90% of these rats died. However, all rats that received phantom genetic information,
survived [3]. Later, these findings were confirmed by the work of A. Kokaya, N. Kokaya, and
G.G. Tertyshniy’s group.
In 2014, we obtained preliminary data on materialization of DNA phantoms, obtained in the
form of spectra of secondary LGN-303 laser radiation, generated by laser reading of DNA
segments of a certain length [4].

*Correspondence: Peter Gariaev, Ph.D., Quantum Genetics Institute, Maliy Tishinskiy per. 11/12 — 25, Moscow 123056, Russia.
Email: gariaev@mail.ru
1Readers may find out more about the DNA Phantom Effect and DNA phantoms in the author’s monographs “Wave
Genome”'(1994) and “Linguistics Wave Genome. Theory and Practice” (2009) by searching the Internet.
DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential
Quantum Equivalent of Material DNA
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
2
These experimental results have significant potential value. They confirm A.G. Gurvich’s
(1920’s — 40’s) fundamental idea about genes functioning as wave forms. This means that now
we can work in the field of new genetics and, consequently, new biology, medicine, agriculture
and computing, and have a new approach to the problem of the origin of life on Earth, and so on.
However, phantom DNA data as equivalents of ordinary material DNA requires independent
verification. Therefore, we appeal to and invite molecular biologists, geneticists and other
scientists to conduct independent experiments. Following is a full description for the method of
detection and materialization of DNA phantoms in a PCR system.
II. Materials & Methods
Step 1. Preparation of the Initial DNA Product
The PCR product, 547bp in length, derived from a synthetic DNA sequence and cloned in a
plasmid, was used as the initial DNA product.
The plus DNA strand:
5’CCTTACGTCAGTGGAGATGTCACATCAATCAACTTGCTTTGAAGACGTGGTTGGAA
CGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTC
GGCAGAGGCATCTTGAATGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGA
GCCACCTTCCTTTTCTACTGTCCTTGCGCGCTATATTTTGTTTTCTATCGCGTATTAAA
TGTATAATTGGGGGACTCTAATCATAAAAACCCATCTCATAAATAACGTCATGCATT
ACATGTTAATTATTACATGCTTAACGTAATTCAACAGAAATTATATGATAATCATCG
CAAGACCGGCAACAGGATTCAATCTTAAGAAACTTTATTGCACGCATTAATGGACTG
GATTGGGGCCAACTCCTACCGTACCTGGCATTACCCTTACGCTGAAGAGATGCTCGA
CTGGGCAGATGAACATGGCATCGTGGTGATTGATGAAACTGCTGCTGTCGGCTTTAA
CCTCTCTTTAGGCATTGGTTTGGAAGCGGGCA-3′
For DNA production through PCR amplification the following primer pair was used:
5′-CCTTACGTCAGTGGAGATGTCACATC-3′;
5′-TGCCCGCTTCCAAACCAATGCCTAAAGA-3′.
Each PCR mixture with a final volume of 25µL contained: 67mM Tris-HCl pH 8.6 at 25°C;
2.5mM magnesium chloride; 16.6mM ammonium sulfate; dNTPs mix at a total concentration of
DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential
Quantum Equivalent of Material DNA
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
3
300µM; primer mix in 0.5µM each; 2.5 units of Taq DNA polymerase and plasmid DNAtemplate in amount of 25ng. PCR temperature regime included:

  • initial denaturation at 94°C — 3 min.;
  • 30 cycles of: 94°C — 30 seconds, 62°C — 30 seconds, 72°C — 40 sec;
  • final synthesis 72°C for 5 minutes.
    The PCR product was purified from primers and other components of the PCR reaction solution
    using a set of reagents for purification implementing SiO2 coated magnetic particles («Sileks»,
    http://www.sileks.com) according to the manufacturer’s recommendations. 10µL of magnetic
    particles with binding capacity for 10 mg DNA were used. The elution of DNA was performed
    in 50µL of elution buffer.
    Step 2. Preparation: Modulated Broadband Electromagnetic Spectrum of DNA Product
    25µL of the aqueous solution of the PCR product was applied to a clean microscope slide and
    used for probing by the helium-neon LHN-303 laser beam for 3 and more minutes. The resulting
    secondary modulated broadband electromagnetic radiation was recorded by a transistor radio at a
    frequency of 700 kHz and then converted into Waveform audio file format. This is the WAVE
    audio file we propose to use for DNA information induction (without the use of in this version
    the LHN-303 laser) into samples of purified water, considering that sound can carry torsion
    information [5], including information about DNA (a hypothesis).
    In addition, and at the same time the audio recording was made, DNA information induction into
    purified distilled water was facilitated by way of a stationary tripod with test tubes containing
    purified distilled water without DNA impurities, RNA and nucleases being placed at a distance
    of 15-20 cm from the laser. The water was pre-frozen at -20°C and thawed at room temperature
    (defrost water).
    DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
    Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential
    Quantum Equivalent of Material DNA
    ISSN: 2159-046X DNA Decipher Journal
    Published by QuantumDream, Inc.
    www.dnadecipher.com
    4
    Step 3. PCR Amplification Using Water Samples Treated by the Modulated Broadband
    Electromagnetic Spectrum of the Initial DNA from which Information Was Read by a
    LGN-303 Laser
    After laser exposure, water treated by the modulated broadband electromagnetic spectrum, was
    used for execution of standard PCR reactions, 25µL of this water was used without addition of
    DNA-template material. Tripod with the tubes was placed at a distance of 20-30 cm from the
    laser. Preparation of the PCR reactions was performed in a sterile environment treated with UV
    light that would prevent contamination of samples.
    Each PCR mixture contained: 67mM Tris-HCl pH 8.6 at 25°C; 2.5mM magnesium chloride;
    16.6mM ammonium sulfate; dNTPs mix at a total concentration of 300µM; primer mix in 0.5µM
    each; 2.5 units of Taq DNA polymerase. Several temperature regimes were used for PCR,
    different in duration of the elongation stage (synthesis) of DNA strands at 72°C.
    Initial PCR temperature regime included:
  • initial denaturation at 94°C — 3 min.;
  • 40 cycles: 94°C — 30 seconds, 62°C — 30 seconds, 72°C — 40 sec;
  • final synthesis at 72°C for 7 minutes.
    Modified PCR temperature regime included:
  • initial denaturation at 94°C — 3 min.;
  • 40 cycles: 94°C — 30 seconds, 62°C — 30 seconds, 72°C — 2.7min;
  • final synthesis at 72°C for 5-7 minutes.
    All temperature regimes resulted in synthesis of PCR products of predetermined length, but to
    varying degrees. The largest number of test specimens with the desired product was obtained
    when using a seven-minute DNA strand elongation step in each of the 40 PCR cycles.
    Step 4. Analysis of PCR Results
    After the completion of the PCR reaction, the samples were mixed with gel loading buffer,
    containing a fluorescent SYBR Green I dye («Sileks», http://www.sileks.com) and were analyzed
    on a 1.5% agarose gel by standard methods of gel electrophoresis in a single TBE buffer. The
    DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
    Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential
    Quantum Equivalent of Material DNA
    ISSN: 2159-046X DNA Decipher Journal
    Published by QuantumDream, Inc.
    www.dnadecipher.com
    5
    results were analyzed with a trans-illuminator at a wavelength of 365nm. Samples were
    considered positive where bands were located at the same distance from the start as the positive
    control strip, corresponding to a known DNA fragment size of 547bp
    PCR positive control samples, samples of the initial DNA product from which the laser reading
    was made, and the experimental samples were subjected to sequencing. Sequencing revealed that
    the experimental samples are 99.2-100% identical to the DNA sequence of the initial product
    from which the information was read by the laser.
    To illustrate our PCR experiments, the images of the PCR DNA phantoms are shown. A link for
    the download of the audio recording of DNA modulated broadband electromagnetic radiation in
    WAVE format on a carrier frequency of 700kGts is also provided2
    .
    Our experiments can be reproduced without the use of a laser and without the original DNAtemplate (as we do too), by using the audio recording. i.e. no need to synthesize the template.
    This prevents accidental drifts of initial DNA into the working tubes with water, the pipettes, etc.
    Thus, we avoid contamination. In this case, the working sound player to be set at a distance of 1
    to 20 cm from the tripod with the test tubes. The exposure time may vary from 5 minutes or
    more. The identity of the resulting PCR DNA product and initial DNA can be confirmed by
    sequencing the obtained DNA. In this type verification, all that is required is the primers and
    knowledge of the initial DNA nucleotide sequence…
  1. First Experiment on PCR Amplification of 12/01/2015 Audio Recording
    (1) Control tudy before exposure to the sound wave recording as a derivative of DNA
    (547bp) MBER spectrum
    Time of PCR cycle 12/21/2015: from 18:00-01:30 (PCR program with 7-minute elongation
    (synthesis) of DNA strands)
    Electrophoresis from 12/24/2015

2 A link to download the audio recording of DNA in wave format:
547bp Sound http://files.mail.ru/A59F39CE29C04CD180132D8885580905
DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential
Quantum Equivalent of Material DNA
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
6
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
Tracks 1-15: The control (background before exposure to the sound) — purified water, commonly
used in PCR reactions as the solvent of reaction components, pre-frozen and thawed. The origin
of the water is the same as the water used at the time of laser recording, it was frozen in the
laboratory.
Track 16: A positive PCR control (plasmid DNA-template 25ng, 30 cycles of PCR)
Track 17: The marker fragments length 139, 268, 450, 613bp
(2) The study of the impact of a sound recording of MBER spectra of DNA (547bp) (WAVE
file) on purified water.
Electrophoresis from 12/25/2015
DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential
Quantum Equivalent of Material DNA
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
7
Tracks 1-15: Purified water, pre-frozen and thawed, treated with the sound of DNA MBER
(WAVE file) for 30 minutes prior to the beginning of the PCR cycle.
A tube with purified water was set in a motionless and stationary tripod, while the soundwave
was aimed directly at the bottom of the tube with a speaker. The water used was the same as used
in the PCR during the study of background before exposure to the sound.
Track 16: A positive PCR control (plasmid DNA template 25ng, 30 cycles of PCR)
Track 17: The marker fragments lengths 139, 268, 450 and 613bp
(3) Observations
1) The new PCR program with a 7-minute DNA elongation (synthesis) step is effective for
primary, and for subsequent PCR-analysis of the target DNA-product synthesis after laser
exposure. Residual background of laser recording, made on 12/01/2015 remained,
however, the amount of the target product was reduced to 3 of 15 tubes, compared with the
PCR performed on the sound recording day (6 of 14 tubes). This is logical, given that
twenty days passed from the date of recording, and taking into account the distance
between the laser recording location and the laboratory, where PCR-analysis was
performed (it is located on the opposite side of Moscow in Domodedovo).
2) Sound exposure doubled the amount of the desired product synthesis (6/15 tubes)
compared to the background before sound (3/15 tubes). Perhaps, sound can be used as a
restorator and repeater of modulated broadband electromagnetic radiation DNAinformation recorded by laser in a system of PCR DNA synthesis. However, clearly it is
too early to make conclusions just from one experiment, although the results are
promising.
3) The genetic information sufficient for reproduction in the PCR system is recorded when the
laser is working and there is primary DNA-reading radiation in optical range. Presumably
the sound, being a result of the conversion of laser frequency into MBER with concurrent
recording of the MBER radio frequency into an ‘audio’ WAVE file format is capable of
producing the primary structure of the initial DNA. This makes it possible to materialize
the initial DNA in a PCR system. So following this, it is possible to use such a DNA-radiofrequency-recording in the acoustic range for broadcasting onto new water samples
DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential
Quantum Equivalent of Material DNA
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
8
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
without the requirement of the direct primary impact of DNA modulated broadband
electromagnetic radiation.
4) It is necessary to repeat the experiment with the new samples of water minimum of 5-6
times, to facilitate more confident discussion about the abilities of “MBER acoustic
waves” as a secondary source of DNA information to produce an impact on water samples
of various origins and subsequently use these water samples in PCR to synthesize the
material DNA.
Second Experiment on PCR Amplification of 12/01/2015 Audio Recording
(1) Control study before exposure to the sound WAVE recording as a derivative of DNA
(547bp) MBER spectrum
Time of PCR cycle 02/03/2016: from 13:10-20:40 (PCR program with 7-minute elongation
(synthesis) of DNA strands)
Electrophoresis from 02/05/2016
Tracks 1-14: The negative control (background before exposure to the sound) — purified water,
commonly used in PCR reactions as the solvent of reaction components, pre-frozen and thawed.
DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential
Quantum Equivalent of Material DNA
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
9
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
The origin of the water is the same as the water used at the time of laser recording, it was frozen
in the laboratory.
Track 15: A positive PCR control (plasmid DNA-matrix 25ng, 30 cycles of PCR)
Track 16: The marker fragments length 300, 400, 500, 600, 700, 800, 900, 1000, 1500bp
(2) A study of the impact of a sound recording (WAVE file) of the modulated broadband
electromagnetic spectra of DNA (547bp) on purified water.
Time of PCR cycle 02/04/2016: from 14.20-21.50 (PCR program with 7-minute elongation
(synthesis) of DNA strands)
Electrophoresis from 02/09/2015
Tracks 1-14: Purified water, pre-frozen and thawed, treated with the sound of DNA modulated
broadband electromagnetic radiation for 30 minutes prior to the beginning of the PCR cycle.
A tube with purified water was sitting in a motionless tripod, while the soundwave was aimed
directly at the bottom of the tube with a speaker. The water used was the same as used in the
PCR during the study of background before exposure to the sound.
Track 15: A positive PCR control (plasmid DNA-template 25ng, 30 cycles of PCR)
DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential
Quantum Equivalent of Material DNA
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
10
Track 16: The marker fragments lengths 139, 268, 450, 613bp
Track 17: The marker fragments lengths 300, 400, 500, 600, 700, 800, 900, 1000, 1500bp
(3) Observations
1) At the time of the experiment, the residual background of laser recording, made on
01.12.2015 remained, however, it became very low — the amount of the target product was
dramatically reduced (2 very low amount of products on tracks 1 and 2), compared with
the PCR performed on the sound recording day. This is logical, given that 2 months passed
from the date of recording. The background in the previous experiment with sound was
stronger, though it was identified in only 2 of 14 tubes. Perhaps, the background of the
recording fluctuates, becoming stronger and then attenuates. However, over time it most
likely attenuates without a new feed in from the laser or sound recording.
2) In this experiment the sound exposure increased the amount of the desired product
synthesis by a factor of 1.5 (3/14 tubes) compared to the background before sound (2/14
tubes). Wherein, the efficiency of information transmission by sound was much weaker
than in the previous experiment with the sound (10/14 tubes). This proves that the sound
can be used as a restorator and repeater of DNA-information recorded by laser in the PCR
system of DNA synthesis, but with a different effectiveness.
3) The effectiveness of the impacting sound may be wave-like in nature, it may be in a peak,
as in the previous experiment, or it may be in a trough, as in this experiment. It is also
possible that sometimes, the sound does not produce any result at all. This indicates that it
is necessary to design and perform a series of experiments, and based on the results, make
conclusions about the quality of the acoustic information transmission. In order to
understand how the intensity peaks and troughs of the effectiveness of the impacting sound
alternate it is expedient to design and perform another series of experiments with a sound
recording to this end.
4) The conditions of the impacting sound and PCR in all three conducted experiments were
the same. However, the efficiency of the previous transmission was much greater. This
suggests the possible influence of the current geomagnetic environment or the influence of
other fields of physical nature throughout the sound exposure. It is also possible that the
influence of the very point in space, where sound exposure took place had an effect.
Perhaps, the tripod with water samples turned out to be in a better point in space in the
previous experiment than in this experiment. How to determine the most efficient tripod
DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential
Quantum Equivalent of Material DNA
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
11
placement is not yet known? Luck only applies at the moment! A ‘unlucky’ possibility is
that the experiment may be performed when the location of the experiment falls into a
point in space where the transfer would be significantly weaker or completely absent. In
any case, a series of experiments is required to confidently speak about the effectiveness of
information transmission by means of sound.
References
[1] Gariaev et al, 1991, Holographic Associative Memory of Biological Systems, Proceedings SPIE — The
International Society for Optical Engineering. Optical Memory and Neural Networks., v.1621, p.280-

  1. USA].
    [2] http://www.plasmalabs.com/files/products/lgn_303_1.pdf
    [3] Gariaev P.P., Kokaya A.A., Mukhina I.V., Leonova-Gariaeva E.A., Kokaya N.G. 2007. The effect of
    biostructures modulated electromagnetic radiation on alloxan diabetes in rats. Bulletin of Experimental
    Biology and Medicine, № 2, pp.155-158.
    [4] Gariaev et al, DNA Decipher Journal / May 2014 Vol. 4 Issue 1/ pp.01-02 Materialization of DNA
    Fragment in Water through Modulated Electromagnetic Irradiation.
    [5] http://www.efir.com.ua/rus/a.php?r=2&d=69
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
    Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
    ISSN: 2159-046X DNA Decipher Journal
    Published by QuantumDream, Inc.
    www.dnadecipher.com
    12
    Article
    Why S?
    Trespassing on an Anthropic Lawn (Part I)
    Graham P. Smetham*
    ABSTRACT
    Mindful reflections upon a metaphysically misguided materialist advertising campaign:
    Trespassing on Einstein’s Lawn: A Father, a Daughter, the Meaning of Nothing, and the
    Beginning of Everything by Amanda Gefter. Gefter, New Scientist book reviews editor, presents
    a philosophically confused account of current quantum metaphysics because she adheres to an
    out of date materialist metaphysics and claims that, whilst observers in some way create reality,
    the process does not involve consciousness. Her claims are shown to invalid, the various
    quantum metaphysical perspectives she covers are shown to require consciousness as
    fundamental.
    Keywords: Grand design, observers, consciousness, anthropic principle, Darwinism,
    evolutionary developmental biology, Cambrian explosion, quantum morphogenetic archetypes,
    buddhanature, nothingness, emptiness, primordial consciousness, timeless awareness, substrate of
    consciousness.
    The Question is what is the Question?
    Is it all a Magic Show?
    Is Reality an Illusion?
    What is the framework of the Machine?
    Darwin’s Puzzle: Natural Selection?
    Where does Space-Time come from?
    Is there any answer except that it comes from consciousness?1
  • John Wheeler
    Wheeler thinks that consciousness could be the criterion for an observer, but
    that’s obviously bullshit. I mean, consciousness is just a physical process in the
    brain. It’s not magic.2
  • Amanda Gefter
  • Correspondence: Graham Smetham http://www.quantumbuddhism.com E-mail:graham@quantumbuddhsim.com
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
    Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
    ISSN: 2159-046X DNA Decipher Journal
    Published by QuantumDream, Inc.
    www.dnadecipher.com
    13
    ..the essence of consciousness can be interpreted as a special type of perception
    of quantum reality by living beings.3
  • Michael Mensky
    I regard consciousness as fundamental. I regard matter as derivative from
    consciousness.4
  • Max Planck
    The recent book Trespassing on Einstein’s Lawn: A Father, a Daughter, the Meaning of Nothing,
    and the Beginning of Everything (TEL) by Amanda Gefter, a science journalist who writes for
    New Scientist, Scientific American and other science journals, has been greeted with some
    enthusiastic reviews. One reviewer describes it:
    Beautifully written and hugely entertaining, this book is a heartfelt introduction to the
    many mind-bending theories in contemporary physics.5

Gefter’s descriptions and explanations of some of the metaphysical conclusions drawn from
modern physical theory, derived from her conversations with the physicists she persuaded to
grant her interviews, are well written, intriguing and entertaining. The physicist Peter Woit
compares TEL to another recent work Why Does the World Exist, wherein the author Jim Holt
interviews various philosophers and scientists on their views on the origin of, and reason for, the
existence of the universe. Woit writes that the authors of both books are:
…lively, entertaining writers with wonderful material about deep questions, and I
greatly enjoyed both books. Gefter is the funnier of the two, and I had trouble putting
the book down after it arrived in my mail a couple of days ago.6
However, Woit also has some severe reservations:
While I liked the book, at the same time I found the whole project deeply problematic,
and would have reservations about recommending it to many people, especially to the
impressionable young. The part of physics that fascinates Gefter is the part that has gone
way beyond anything bound by the conventional understanding of science. … The
questions being discussed and answers proposed are woolly in the extreme, … Not
recognizing that this post-modern way of doing science is deeply problematic and
leading the field into serious trouble isn’t so much Gefter’s fault as that of the experts
she speaks to …. Those taking the field down this path are dominating public coverage
of the subject, and often finding themselves richly rewarded for engaging not in sober
science but in outrageous hype of dubious and poorly-understood ideas. Only the future
will tell whether the significance of this book will end up being that of an entertaining
tale of some excesses from a period when fundamental physics temporarily lost its way,
or a sad document of how a great science came to an end.7
In this criticism Woit implicitly indicates that the central problem that he finds with approaches
to current interpretations within physics lies in the relationship between what he considers to be
‘true’ physical theory, which he considers to be “sober science,” and the metaphysical
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
14
conclusions that are derived from such “sober science.” In this indication Woit has inadvertently
put his finger on a crucial issue that rarely gets clearly examined or articulated.
However, one significant science writer who has taken on this investigation, in his book Farewell
to Reality: How Fairy Tale Physics Betrays the Search for Scientific Truth, is Jim Baggott, who
writes:
…I’m going to accuse a bunch of theoretical physicists of abandoning the scientific
method and so betraying the search for scientific truth about the nature of physical
reality … I will seek to reject fairy-tale physics as metaphysics.8
The proposals that Baggott identifies as “fairy-tale physics” are the stuff of popular science
writing: string theory, supersymmetry, M-theory, Many Worlds and the Multiverse, the
Holographic Principle and so on. Some of the perspectives that Baggott seeks to chastise are
also amongst those enthusiastically and breathlessly expounded by Gefter.
The term ‘metaphysics’ is, according to many, notoriously difficult to define. Originally the
term was used simply to indicate the works of Aristotle which he wrote after his works which
purported to deal with purely ‘physical’ phenomena. The philosopher Peter van Inwagen
describes the Aristotelian notion of metaphysics:
Metaphysics is about things that do not change. In one place, Aristotle identifies the
subject matter of first philosophy as “being as such,” and, in another, as “first causes.” It
is a nice—and vexed—question what the connection between these two definitions is.
Perhaps this is the answer: The unchanging first causes have nothing but being in
common with the mutable things they cause—like us and the objects of our
experience…9
Thus we see that originally the term ‘metaphysics’ denoted the exploration and description of the
deep, core, fundamental structures of reality, at the very deepest level it has to do with the
unchanging ‘stuff’ of reality which gives rise to the changing phenomena of our experiential
world. Furthermore, it is clearly essential that metaphysics also elucidates the relationship
between ‘pure being’ and the phenomena that arise from its changeless essence. In Buddhist
Yogācāra terminology, as we have seen, ‘pure being’ is dharmata, and the manifested
phenomena are dharmas.
Today, however, the metaphysical task has been handed over to physics, despite Baggott’s
mistaken notions. We shall see that Baggott’s rigid distinction between physics and metaphysics
is mistaken. Indeed, the significant physicist Abner Shimony referred to the experimental
investigation of the deepest quantum layer of reality accessible to us, in experiments of Bell-type
inequalities, precisely as “experimental metaphysics.”10
In this case, then, wherein physics
investigates and describes the deepest quantum level of reality, we see that physics dissolves into
metaphysics. Indeed, there is a fuzzy, hazy boundary between physics and metaphysics. And,
furthermore, it is important to be cognisant of the fact that originally physics was based on a
metaphysical commitment to materialism, a commitment which its own development has now
crucially undermined. The notion that physics and metaphysics can be sharply separated is, then,
mistaken. Furthermore, the notion that it is invalid to draw metaphysical conclusions, such as
that of the Anthropic Principle, on the basis of the evidence of physics and the other sciences is
equally misguided.
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
15
Baggott’s use of the term ‘metaphysics’ is not of the Aristotelian kind. His use has more to do
with the use of the term by the twentieth century ‘logical positivists’, for whom the meaning of a
scientific statement consisted entirely in the predictions it made about possible experience, and
any statements which went beyond such statements were asserted to be meaningless
‘metaphysical’ statements. Baggott claims that:
There is as yet no observational or experimental evidence for many of the concepts of
contemporary theoretical physics, such a super-symmetric particles, superstrings, the
multiverse, the universe as information, the holographic principle, or the anthropic
cosmological principle. For some of the wilder speculations of the theorists there can by
definition never be any such evidence.11
However, whilst it may be the case that “some of the wilder speculations” are completely devoid
of evidential backing, it can be shown that this is not true of the Anthropic Principle. In fact the
opposite is the case, there is overwhelming evidence for an anthropic principle, which asserts
that the development of sentience and consciousness is a primary and fundamental feature of the
process of reality.
In his chapter on the Anthropic Principle, Baggott clearly indicates that he rules out the
Anthropic Principle purely on the grounds of what is called the ‘Copernican Principle’, which is
the dogmatic assertion that the universe cannot be Anthropic. This assertion is not based on any
evidential grounds. Baggott indicates that he is uneasy with the fact that the Anthropic Principle
clearly has religious and spiritual implications. But Baggott presents no evidence which
counters or undermines the Anthropic Principle, he simply dogmatically rules it out as being
unscientific in principle.
The ‘Copernican Principle’ is named after the Renaissance mathematician and astronomer
Nicolaus Copernicus, who realized that the Earth is not the center of the solar system, as was
thought at the time, but, rather, the Sun has that central role. It is thought by supporters of the
Copernican Principle that the erroneous notion of the Earth being the center was an example of
the people at the time overestimating their own importance, rather than just making a mistake
based upon the evidence available at the time. Supporters of the Copernican Principle claim that
any assertion which seems to privilege human life in any way must be considered anti-scientific,
whatever the evidence. When applied to the Anthropic Principle, the Copernican Principle has
become a dogmatic decision on the part of a large section of the scientific community to
disregard, and even suppress by nefarious means, evidence suggesting that consciousness is not
only a primary feature of the process of reality, but also has a role in creating what appears to be
the ‘material’ world and the sentient organisms within it.
Baggott describes the Copernican Principle (or prejudice):
The universe is not organized for our benefit and we are not uniquely privileged
observers. Science strives to remove ‘us’ from the centre of the picture, making our
existence a natural consequence of reality rather than the reason for it. Empirical reality
is therefore something that we have learned to observe with detachment, without
passion. Scientists ask fundamental questions about how reality works and seek answers
in the evidence from observation and experiment, irrespective of their own personal
preferences, prejudices and beliefs.12
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
16
The problem with this presentation, however, is that it seems to suggest that a failure to “remove
‘us’ from the centre of the picture” is a result of a lack of detachment, a pandering to “personal
preferences, prejudices and beliefs.” But nothing can be further from the truth, as Roger
Penrose has pointed out with regard to the relationship between quantum theory and
consciousness:
Quantum theory was not wished upon us by theorists. It was (for the most part) with
great reluctance that they found themselves driven to this strange and, in many ways,
philosophically unsatisfying view of the world.13
The early explorers of the quantum realm did not consciously seek to erect some form of
mystically inspired physical theory, to begin with they were shocked by their discoveries.
However, the evidence moved towards an inescapable endpoint, as master quantum physicist
John Wheeler, toward the end of his life, concluded:
The Question is what is the Question?
Is it all a Magic Show?
Is Reality an Illusion?
What is the framework of the Machine?
Darwin’s Puzzle: Natural Selection?
Where does Space-Time come from?
Is there any answer except that it comes from consciousness?
What is Out There?
T’is Ourselves?14

Physicist Anton Zeilinger has written in appreciation of Wheeler’s:
…realisation that the implications of quantum physics are so far-reaching that they
require a completely novel approach in our view of reality and in the way we see our
role in the universe. This distinguishes him from many others who in one way or
another tried to save pre-quantum viewpoints, particularly the obviously wrong notion
of a reality independent of us.15
So, whereas Baggott claims that we must keep ‘US’ out of the scientific picture whatever the
evidence, Wheeler and Zeilinger claim that the evidence of quantum physics indicates the central
significance of ‘US’ in the process of reality. And they are not alone, physicist and philosopher
Bernard d’Espagnat, for another example, writes that:
The doctrine that the world is made up of objects whose existence is independent of
human consciousness turns out to be in conflict with quantum mechanics and with facts
established by experiment. 16
There is a dramatic amount of evidence that consciousness is fundamentally significant in the
process of reality and the evolution of life and the universe. In other words Wheeler and others
have drawn the conclusion, based upon quantum theory and the fact of a seemingly miraculous
fine-tuning of physical parameters, that ‘US’ or some form of intelligence is somehow involved
in the evolution of life and the universe.
One example of spectacular fine-tuning of the physical constants of the universe is the
generation of carbon in the process of stellar nucleosynthesis. The cosmologist Fred Hoyle
famously stated in this context:
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
17
Would you not say to yourself, “Some super-calculating intellect must have designed
the properties of the carbon atom, otherwise the chance of my finding such an atom
through the blind forces of nature would be utterly minuscule? A common sense
interpretation of the facts suggests that a superintellect has monkeyed with physics, as
well as with chemistry and bio logy, and that there are no blind forces worth speaking
about in nature. The numbers one calculates from the facts seem to me so overwhelming
as to put this conclusion almost beyond question.”17
The notion of a “super-calculating intellect,” of course, moves us in the direction of theism.
However this is not a necessity in the Anthropic context, Wheeler, for instance, thought of the
process of the self-production of the universe as being the result of the intersubjective collective
perceptual activities of all sentient beings:
Directly opposite to the concept of universe as machine built on law is the vision of a
world self-synthesized. On this view, the notes struck out on a piano by the observer
participants of all times and all places, bits though they are in and by themselves,
constitute the great wide world of space and time and things.18
In order to graphically represent this perspective Wheeler employed his ‘self-perceiving universe
image (figure 1), in this case the self-perceiving U does represent ‘US’.
In this context it is worth pointing out that the Anthropic Principle, a term coined in 1974 by the
theoretical physicist Brandon Carter, is often misrepresented as being the claim that it is solely
human life that is the end point of the anthropic process, rather than sentient life in general. As
the philosopher Nick Bostrom has pointed out:
Figure 1
The term “anthropic” is a misnomer. Reasoning about selection effects has nothing to
do with homo sapiens, but rather with observers in general. Carter himself regrets not
having chosen a better name.19
It is also necessary to point out the distinction between the so-called Weak Anthropic Principle
which simply states that the universe we find ourselves in must be anthropic because we exist,
but it might have been otherwise, and the Strong Anthropic Principle which asserts that it is the
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
18
very nature of the universe to be Anthropic. On this view, life and sentience are the reason for
the universe’s existence, so to speak, and there is an innate intelligence and fundamental
awareness and internal consciousness which unfolds within the process of the evolution of life
and the universe.
However, there is a deep reluctance, verging on a dogmatic prejudice, against allowing such
evidence to be entertained because the implications, especially in the sphere of spirituality, are
significant and important. And this antagonism has been enshrined in the so-called ‘Copernican
Principle’ which has been elevated by some to an inviolable principle of the scientific method.
Baggott for example writes:
I don’t think we need to waste time debating whether the strong anthropic principle, or
indeed any similarly structured principle, is scientific. Any structure designed to
completely overturn the Copernican Principle and restore some kind of privileged status
to intelligent observers (be they human or not) goes against the grain of nearly five
hundred years of scientific practice.20
However, in making such a sweeping and dogmatic statement Baggott is clearly ignoring the
most crucial feature of the scientific method which is that, as Baggott himself writes in his book,
scientists should “seek answers in the evidence from observation and experiment, irrespective of
their own personal preferences, prejudices and beliefs.”21 There is, however, absolutely no
“evidence from observation and experiment” which supports the Copernican Principle, it is much
more akin to “personal preferences, prejudices and beliefs.”22
As Brandon Carter pointed out
about the Copernican Dogma:
Unfortunately there has been a strong (not always subconscious) tendency to extend this
to a most questionable dogma to the effect that our situation cannot be privileged in any
sense.23
The evolutionary biologist Richard Lewontin stated a particularly egregious version of the
Copernican Principle which indicates that materialism must be adhered to, whatever the
evidence against it, in order to further science’s supposed intellectual war with religion:
Our willingness to accept scientific claims that are against common sense is the key to
an understanding of the real struggle between science and the supernatural. We take the
side of science in spite of the patent absurdity of some of its constructs, in spite of its
failure to fulfill many of its extravagant promises of health and life, in spite of the
tolerance of the scientific community for unsubstantiated just-so stories, because we
have a prior commitment, a commitment to materialism. It is not that the methods and
institutions of science somehow compel us to accept a material explanation of the
phenomenal world, but, on the contrary, that we are forced by our a priori adherence to
material causes to create an apparatus of investigation and a set of concepts that produce
material explanations, no matter how counter-intuitive, no matter how mystifying to the
uninitiated. Moreover, that materialism is absolute, for we cannot allow a Divine Foot in
the door.24
Lewontin, like Baggott, seems oblivious to the scientific requirement to take observations and
evidence seriously.
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
19
This antagonism towards any evidence which points towards the fundamental and innate
presence of awareness, consciousness, intelligence and design (not necessarily of a theistic
nature) in the evolution and development of life and the universe runs very deep in some
Western intellectual cadres. It derives from certain political, social and academic forces in the
late nineteenth and early twentieth centuries, forces which favoured materialist Darwinism in the
face of any contrary evidence. In the most extreme form it manifests in the ridiculous strident
and pugilistic assertions of crude materialism and crude Darwinian fundamentalism as displayed
by the likes of Richard Dawkins and friends. But the intellectually undermining influence of
academic materialism, crude or subtle, permeates and exercises an influence upon a great deal of
modern intellectual, academic and popular culture, thus the great popular taste for the writings
of Dawkins, even though his many of his metaphysical claims can be shown to be dubious.
Such is the pervasiveness of this fundamentalist materialism that it pervades works such as
Gefter’s TEL, even though the very metaphysical accounts conveyed to Gefter by various
physicists are entirely contrary to any materialist account of the process of reality. In Gefter’s
hands they are sanitised for the materialist cause by Gefter’s stubborn refusal to figure out that
the notion of an ‘observer’ without the presence of consciousness is absurdly incoherent. Gefter
appears to have a detailed understanding of the groovy, weird and wonderful things that current
physics indicates about the nature of reality, yet she fails to appreciate that any moderately
metaphysically coherent intellect would consider the perspectives described to her by most of
the physicists she interviews to be antithetical to any form of materialism.
Consider for example, the physical-metaphysical perspective proposed by Wheeler as described
by physicist Paul Davies, Gefter writes concerning Wheeler’s notion of “a participatory
universe”:
If measurements built the universe bit by bit, as Wheeler suspected, then observers
were somehow implicated in the creation of reality — a radical picture that, if true,
would mean ours was a participatory universe. As the physicist Paul Davies wrote,
“Wheeler seeks to … turn the conventional explanatory relationship
matter→information →observers on its head, and place observership at the base of the
explanatory chain: observers→information→matter … could it somehow be that
observers turn nothing into something? The idea seemed impossible from the start,
because where would the observers come from? What would even count as an
observer? Surely it did not have to be conscious or human … but what?25

The fact that it appears that “measurements built the universe bit by bit” derives from the
quantum situation that prior to a “measurement” being carried out by an “observer” there is only
a quantum realm of potentiality, which is not a “nothing” — Gefter, like some others, is very
slap-dash with some of her terminology regarding the ground quantum state. This quantum
realm of potentiality becomes an experienced, and apparently ‘material’, reality when a
measurement “collapses” the quantum wavefunction of potentiality.
On this view, the activity of a multitude of acts of observation are required to build an
experiential-material universe over time. This was Wheeler’s fundamental view. And it is a
view which clearly requires the acceptance that observership, and therefore consciousness, is a
fundamental and primary aspect of the process of reality. In other words, there must be some
kind of internal pressure of “observership,” not fully individuated and conscious at the ground
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
20
level of course, but having the nature of undifferentiated primordial consciousness. The process
of the deeper levels of “observership” eventually produces the multitude of sentient organisms
which continue to maintain the universe through their observations. Such a view is clearly
strongly anthropic.
Gefter refers to such an anthropic perspective as “top-down” as opposed to the conventional
“bottom-up” approach. It is “top-down” in the sense that, like Mensky’s notion of a “LifePrinciple” operating at the quantum level in order to unfold the potentialities for life which are a
fundamentally innate aspect of the quantum realm, this perspective requires that we accept that
life and consciousness are internal, and primary, aspects of the ground of the process of reality.
Gefter writes about this:
Anthropic coincidences are problematic for bottom-up cosmology because you are
starting with an initial state that’s completely independent of observers; the universe
evolves forwards in time until observers like us just happen to arise, a fluky by-product
of physics and happenstance. Given random initial conditions some 14 billion years
ago, of course we’re scratching our heads and asking, what were the odds that the
universe would just happen to have every minute ingredient to cook up the fragile stew
of life? Top-down cosmology, on the other hand, doesn’t raise the question … top down
cosmology starts with observers … And if you start with life, you are bound to end up
with a life-friendly universe. Why an anthropic principle? … Because the universe is
observer dependent. Such jewel-toned thoughts about life made me nervous — any
theory which relied on humans or consciousness as being some kind of “special”
ingredient struck me as crackpot.26
So, here we have it, Gefter dismisses the notion of a top-down development of life and the
universe, not on the basis of evidence or cogent reasoning, but, rather, she kind of feels in her
bones, so to speak, that such a notion must be “crackpot.” It does not occur to her that, not only
does the evidence support this psycho-metaphysical viewpoint, it is also the only logically
coherent possibility. The notion that life and consciousness can emerge from entirely lifeless
and entirely blankly non-conscious fundamental aspects of reality is absolutely logically
incoherent and therefore definitely “crackpot.”
At the same time as Gefter revels in the frisson of an “observer-dependent” reality, she, as we
shall see, also, inconsistently, supports the current academic prevalence of crude materialist
dogma. Like many others she seems to be incapable of drawing obvious conclusions because of
a preformed dogmatic prejudice concerning any viewpoint which draws spiritual conclusions
from the modern discoveries on the part of physics. Bizarre and contradictory it may be but, at
the same time as she seems to support her father’s view that the universe is some kind of illusion
generated from a “homogeneous state” of “nothingness” (which itself is a misuse of the term
“nothingness” which should mean absolute zilch – not even a glimmer of potentiality), and that
the process of reality and the universe is “observer-dependent,” she also upholds the materialist
worldview, supporting a crude materialist Darwinism.
Gefter also holds to the view that consciousness has nothing to do with the fundamental
observer-dependency of the universe. In her worldview consciousness is asserted to be
generated by material brain processes:
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
21
Wheeler thinks that consciousness could be the criterion for an observer, but that’s
obviously bullshit. I mean, consciousness is just a physical process in the brain. It’s not
magic.27
This means that, in her universe, which she asserts is “observer-dependent,” observation can take
place without the presence or activity of consciousness. According to Gefter:
It was also clear that we needed to give careful consideration to the meaning and role of
“observers” in general. Both relativity and quantum theory had changed the role that
observers played in physics – not observers as humans or conscious creatures, but
observers as in points of view.28
Such bizarre formulations indicate the remarkable philosophical incompetence on Gefter’s part.
The notion of free-floating “points of view,” having no reference to any kind of experiential
substrate able to experience and be aware of the “point of view” is incoherent. This claim
elevates the notion of a “point of view” to an elementary feature of the process of reality, a claim
which is philosophically unacceptable precisely because the concept of a “point of view”
requires the experiential medium of consciousness.
However, this attempted objectification of the notion of a “point of view” indicates what is going
on here. This move amounts to what Zeilinger calls an attempt to “save pre-quantum viewpoints,
particularly the obviously wrong notion of a reality independent of us.”29
In the scientific
revolution of the seventeenth century mind and consciousness were removed from the scientific
description because of not being amenable to mathematical quantification. Subsequently the
notion of consciousness became problematic and, due to the remarkable achievements of the
scientific method in investigating, harnessing and controlling the phenomena of material reality,
it was assumed that matter was the ultimate substance and consciousness was considered to be
derivative. Consciousness, then, was simply assumed to be irrelevant to any ultimate
description of the process of reality.
This assumption, however, was overturned within the quantum revolution wherein consciousness
was shown to have a subtle interconnection with the quantum realm, interacting with it in order
to produce experienced ‘material’ reality. As physicists Bruce Rosenblum and Fred Kuttner
write in their book Quantum Enigma: Physics Encounters Consciousness:
…physics’ encounter with consciousness, demonstrated for the small, applies to
everything. And that ‘everything’ can include the entire Universe.30

This indicates the primary nature of consciousness. However, resistance to this conclusion is still
prevalent amongst a rearguard community of adherents to the metaphysical worldview of
materialism, and in order to “save the appearances” of this outmoded worldview adherents
simply rearrange language to suit their purposes. Thus “points of view” become active agents on
their own behalf, having, according to Gefter’s up-side-down and inside-out perspective, no
connection with consciousness. Gefter writes:
“Observers” didn’t mean people, and “observer-dependency” didn’t mean subjective.
But I could imagine how it could all be misconstrued.31
But, as we shall see, Wheeler did mean “people” (and animals). It might be true that the universe
is not entirely subjective, Wheeler’s perspective requires us to consider it to be an intersubjective
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
22
creation. However, Gefter’s absurd misconstrual here is the confident, and mistaken, assertion
that “observers” and “observer-dependency” have nothing to do with consciousness.
Gefter has great admiration for Wheeler, praising his poetic approach to exploring some of the
deepest mysteries of physics and existence, but at the same time she is wary of his views on the
issue of the agency of consciousness. Wheeler asserted that the universe has been built up, bit by
bit, from the quantum “smoky haze of possibility” (not “nothingness”) by acts of observation
made by sentient beings. Gefter observes:
But what exactly did Wheeler mean by an observer? Without careful clarification
observer was a dirty word. … Wheeler himself acknowledged the problem. “Any
exploration of the concept of ‘observer’ and the closely associated notion of
‘consciousness’ is destined to come to a bad end in an infinite mystical morass,” he
wrote. And yet at times he teetered dangerously on the banks of the morass, his view of
observers skewed far more towards minds than rods or clocks.32

And it is true that Wheeler did tread a very fine line, it may even be said that at earlier times in
his career he hedged his bets, and it is interesting and illuminating to consider why this might
have been the case.
In a 1983 article Law Without Law, wherein he described the delayed choice experiment, which
demonstrates how an observation can determine the nature of reality backwards in time, Wheeler
wrote the following observations:
We are inescapably involved in bringing about that which appears to be happening.33
And:
Many investigators, believing that the greatest insights are to be won from nature’s
strangest features are … giving fresh coverage of the strange “observer-participancy”
forced to our attention by the quantum.34
And:
Useful as it is under everyday circumstances to say the world exists “out there”
independent of us, that view can no longer be upheld. There is a strange sense in which
this is a “participatory universe.”35
And:
Is the term “big bang” merely a shorthand way to describe the cumulative consequence
of billions upon billions of elementary acts of observer-participancy reaching back into
the past…36
And:
Yes, oh universe, without you I would not have been able to come into being. Yet you,
great system, are made of phenomena; and every phenomena rests on an act of
observation. You could never even exist without elementary acts of registration such as
mine.37
And:
Beyond particles, beyond fields of force, beyond geometry, beyond space and time
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
23
themselves, is the ultimate constituent the still more ethereal act of observerparticipancy?38
And yet, despite these stirring and repeated assertions of the “observer-participatory” nature of
the universe, Wheeler also asserted in this article that:
We cannot speak in these terms without a caution … The caution: “Consciousness” has
nothing to do with the quantum process. We are dealing with an event which makes
itself known by an irreversible act of amplification, by an indelible record, an act of
registration.39
But one must ask in this context: how does Wheeler know this? What possible result or results of
quantum experimentation validate this conclusion? None! If observer-participation is clearly
required for the manifestation of the universe, and the most natural assumption is that
observation is a phenomenon that requires consciousness, then the most obvious conclusion is
that consciousness is implicated. So why does Wheeler, in this 1983 article, issue such a stern
warning?
In order to appreciate a possible answer it is useful to look into the intellectual climate and
expectations within the physics establishment at that time and the years preceding. Rosenblum
and Kuttner are physicists who have no doubt about the connection between consciousness and
the quantum ground of reality:
Consciousness and the quantum enigma are not just two mysteries; they are the two
mysteries; first, our physical demonstration of the quantum enigma, faces us with the
fundamental mystery of the objective world ‘out there;’ the second, conscious awareness,
faces us with the fundamental mystery of the subjective, mental world ‘in here.’
Quantum mechanics seems to connect the two.40
They also indicate the intellectual climate of mainstream physics since the 1950’s, extending
down to recent times:
In physics departments a conforming mindset increasingly meant that an untenured
faculty member might endanger a career by serious interest in the fundamentals of
quantum physics. Even today it is best to explore the meaning of quantum mechanics
while also working a ‘day job’ on a mainstream physics topic.41
In his excellent book How the Hippies Saved Physics David Kaiser indicates that in the 1960’s
and 70’s physics in the United States was a conservative profession not enamored of
metaphysical speculation or research. The general attitude amongst working physicists was that
of “shut up and calculate,” the idea being that it was the practical results of research that
mattered, and speculation about exactly what quantum theory implied about the metaphysical
nature of reality was to be avoided. The ethos was very different to that which held sway during
the early development of quantum theory when discussions between Einstein, Bohr, Heisenberg,
Schrödinger and the other ‘founding fathers’ were replete with puzzled philosophical
speculations as to what the weird behaviour of the quantum realm might actually indicate about
the nature of reality. Kaiser observes that later in the United States:
The quarter century during which this Cold War style reigned witnessed an extraordinary
buildup of calculating skill. At the same time, an intellectual trade-off slipped by
unnoticed, with wide-ranging implications. For every additional calculation of baroque
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
24
complexity that physics students tackled during the 1950’s and 1960’s, they spent
correspondingly less time puzzling through what all of those fancy equations meant,
what they implied about the world of electrons and atoms. The fundamental strangeness
of quantum reality had been leeched out.42
Interest in quantum philosophical and metaphysical issues was a fringe activity.
Later, however, this anti-metaphysical attitude changed. The Fundamental Fysiks Group (FFG)
was founded in San Francisco in May 1975 by two physicists, Elizabeth Rauscher and George
Weissmann, at the time both graduate students at the University of California, Berkeley. The
group held informal discussions on Friday afternoons to explore the philosophical implications
of quantum theory. Leading members included Fritjof Capra, John Clauser, Philippe Eberhard,
Nick Herbert, Jack Sarfatti, Saul-Paul Sirag, Henry Stapp, and Fred Alan Wolf. According to
Kaiser:
The ways and means of being a physicist came unmoored in a way they hadn’t been for
two generations. No longer would the attitude of “shut up and calculate” hold sway
unchecked. Sitting around the large conference table at the Lawrence Berkeley
Laboratory with few other demands on their time, they sought to recapture the sense of
excitement, wonder, and mystery that had attracted them to physics in the first place, just
as it had animated the founders of quantum mechanics.43
Amongst this fringe group an interest in connections between quantum phenomena,
consciousness and psychic phenomena was central, figure 2 shows a ‘roadmap’ drawn out by a
member of the group for their research and metaphysical explorations.
Jack Sarfatti was one of the few physicists who was very enthusiastic about Wheeler’s
metaphysical speculations at that time. He wrote:
In my opinion, the quantum principle involves mind in an essential way …. the structure
of matter may not be independent of consciousness. Some component in the quantum
probability involves the turbulent creative sublayer of ideas in the mind of the
“participator.”44
Wheeler, however, kept his distance from these wayward fringe physicists. Sarfatti and Wolf
were keen to work with Wheeler but Wheeler “politely declined”45 their requests. So it would
seem that Wheeler at that time was keen not to veer too far from academic respectability. It can
be seen from the ‘roadmap’ for explorations based on the important implications of quantum
entanglement that the FFG were aware that the new emerging quantum worldview might support
the existence of phenomena such as ESP and psychokinesis, phenomena that were dogmatically
ruled out within a ‘classical’ worldview. They saw the possible implications of an “observercreated world.”
Wheeler’s disavowal of the role of consciousness at this time actually lacks credibility as he also
wrote in Law Without Law:
Are billions upon billions of acts of observer-participancy the foundation of everything?
We are about as far as we can be today from knowing enough about the deeper
machinery of the universe to answer this question. Increasing knowledge about detail
has bought increasing ignorance about plan. The very fact that we can ask such a
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
25
strange question shows how uncertain we are about the deeper foundations of the
quantum and its ultimate implications.46
In the light of such “uncertainty” about “deeper foundations of the quantum and its ultimate
implications” it is difficult to see how Wheeler could be so certain at that time that
“Consciousness has nothing to do with the quantum process.” It seems very likely that such
statements were made with deference to academic respectability. As we know he later changed
his mind on this issue and he connected up the notion of observership with consciousness:
Unless the blind dice of mutation and natural selection lead to life and consciousness
and observership at some point down the road the universe could not have come into
being in the first place…47
Figure 2. The FFG’s ‘Roadmap’ of quantum possibilities for the paranormal.
In other words the universe could not come into being without the emergence of “consciousness
and observership.” But what Wheeler failed to see, at least at this point, is that life and
consciousness must have been already implicit or potential at the point of the big bang, which
was actually a quantum fluctuation in a vast quantum field of potentiality, a field that Mensky
terms the ‘Alterverse’ – the vast pool of possible alternative histories of the universe.
Furthermore, because consciousness is involved in the unfolding of the universe, the process
cannot be driven by “the blind dice of mutation and natural selection.” The materialist
Darwinian worldview is entirely out of place in Wheeler’s quantum psycho-metaphysics, as we
have seen in a previous Wheeler quote he indicated that “Darwin’s Puzzle: Natural Selection …
comes from consciousness.” And in this case the kind of “natural selection” involved cannot be
the random “blind watchmaker” variety, for the unfolding of life requires that consciousness
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
26
steers in the direction of life through some sort of quantum ‘look-ahead’ mechanism such as
Mensky’s ‘postcorrection’ mechanism.
Wheeler described the meaning of his “universe as a self-excited circuit” graphic image (figure
1) as follows:
Beginning with the big bang, the universe expands and cools. After eons of dynamic
development it gives rise to observership. Acts of observer-participancy – via the
mechanism of the delayed choice experiment – in turn give tangible “reality” to the
universe not only now but back to the beginning. To speak of the universe as a selfexcited circuit is to imply once more a participatory universe.48

And the caption for the image is:
Starting small (thin U at upper right), it grows (loop of U) and in time gives rise (upper
left) to observer-participancy – which in turn imparts “tangible reality” … to even the
earliest days of the universe.49
Physicist Kip Thorne explained Wheeler’s perspective to Gefter as follows:
From a certain point of view, which Wheeler adopts, systems can become classical only
when observed. They behave quantum mechanically … until observed, and the
observation collapses the wavefunction. So Wheeler conceives of the universe as
having been born and having evolved quantum mechanically until it naturally generates
life. Then that life performs the observation that collapses the state of the universe to
make it classical. It is self-excited in the sense that the observation comes from within
the universe, not from the outside.50

Gefter then asks Thorne: “Does it have to be biological life that makes the observation?” and
Thorn tells her that this was Wheeler’s view.
Wheeler, however, did not at this point seem to be aware that “observer-participancy” could not
have suddenly sprang into operation from nowhere, it must have been implicit or potential from
the beginning. Furthermore, the mechanism of “observer-participancy” must have been
operative in some form even when fully organic beings where not yet fully evolved. In other
words the mechanism of self-excitation, self-observation, or self-registration must be a
fundamental mechanism employed by a deep non-individuated primordial consciousness, and
the employment of this mechanism results in the development and evolution of the universe and
the sentient beings it contains. In other words, primordial consciousness is able to individuate
through a Wheeler-type mechanism of universal internal self-perception. This Wheeler-type
mechanism corresponds in an important way with Mensky’s psycho-metaphysics, in both
perspectives evolutionary choices are made through a quantum mechanism involving
consciousness from the reference point of a future point in time. And, as we saw in the first
chapter the same is true of the quantum metaphysics outlined by Hawking & Mlodinow in their
book The Grand Design.
Gefter, however, seems dogmatically predisposed to reject notions of consciousness being at all
involved in the development of the universe and the sentient life within it:
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
27
I couldn’t see how bringing consciousness into the mix could possibly help — not least of
all because scientists don’t know what consciousness is. Whatever it is, it’s governed by
the same laws of physics and composed of the same particles, fields, or informationtheoretic bits as everything else.51
Here we find Gefter stating her own prejudices, admittedly derived from the deep-seated
materialism that pervades so much scientific and academic discourse, as if they were backed by
evidence or reasoning, which they are not. Her views on the nature of consciousness are nothing
other than materialist dogma. Consciousness cannot be composed of ‘particles’ precisely
because particles come into being when consciousness interacts with quantum wavefunctions of
potentiality. So consciousness is more fundamental than particles. It may be possible to
consider consciousness as a quantum field, but in this case it would be a fundamental quantum
field capable of interacting with other quantum fields in creative ways. This would render
consciousness as being an essential creative feature of the ‘physical’ world. The quantum
cosmologist Andre Linde has mused in this context:
Is it possible that consciousness, like spacetime, has its own intrinsic degrees of freedom
and that neglecting these will lead to a description of the universe that is fundamentally
incomplete? What if our perceptions are as real as (or maybe, in a certain sense, are
even more real) than material objects?52
And Linde has also observed:
The universe and the observer exist as a pair. … The moment you say that the universe
exists without any observers, I cannot make any sense out of that. I cannot imagine a
consistent theory of everything that ignores consciousness. A recording device cannot
play the role of an observer, because who will read what is written on this recording
device? In order for us to see that something happens, and say to one another that
something happens, you need to have a universe, you need to have a recording device,
and you need to have us. It’s not enough for the information to be stored somewhere,
completely inaccessible to anybody. It’s necessary for somebody to look at it. You need
an observer who looks at the universe. In the absence of observers, our universe is
dead.53
Furthermore, in the absence of conscious observers the universe is only quantum potentiality, no
‘classical’ world exists. Such a viewpoint, which was accepted by several of the ‘founding
fathers’ of quantum theory, and is accepted today by scientists such as Linde, Roger Penrose,
Stuart Hameroff, Henry Stapp, Amit Goswami, Mensky and others, is, it seems, rejected by
Gefter without rhyme or reason.
Gefter’s claim that most scientists assert that they do not know what consciousness is, on the
other hand, true. But the reason for this is that scientists in general approach the phenomenon of
consciousness with a ridiculous methodology, expecting to be able to examine it “out there” as if
it were some kind of externally existing fluid-like ‘stuff’. This, of course, is not possible. If we
want to directly know what consciousness is there is only one way to know, and that is to
experience directly through advanced meditation techniques such as exist in the Buddhist
tradition. In Buddhist psycho-metaphysics there are levels or degrees of consciousness, which
can be directly experienced by advanced meditation techniques. The basic division is that
between jnana, which is fundamental nondual consciousness or wisdom-awareness, and vijnana
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
28
or divided, dualistic everyday consciousness. Everyday consciousness is the “glow of the ground
of being” 54 manifesting in the dualistic world. The West’s understanding is primitive in
comparison to Buddhist psycho-metaphysics.
If we require a definition of consciousness, then one derived from Buddhism will suffice. Here
is a description of the fundamental nature of mind or consciousness given by the Dalai Lama:
The knowing nature, or agency … is called mind and this is non-material … Cognitive
events possess the nature of knowing because of the fundamental nature of clarity that
underlies all cognitive events. This is … the mind’s fundamental nature, the clear light
nature of mind.55
If we want to know where the “clear light nature of mind,” which provides the functionality of
knowing and cognizing, arises from then, as Mensky points out:
…the phenomena of life and consciousness cannot be mechanistically reduced to the
action of the laws of science as they are found in the course of exploring [inanimate]
matter. The explanation of these phenomena on the basis of quantum mechanics requires
[the] addition of a special independent element to the set of quantum concepts and laws.
Such a new element of theory should directly connect quantum concepts with the
concepts characteristic of life. The simplest way to find this element is to consider the
phenomenon of consciousness and compare it with the description of observation
(measurement) in quantum mechanics. 56
The fundamental qualitative aspect of fundamental awareness which manifests as individuated
consciousness must reside at the quantum level. As physicist Nick Herbert (one of the members
of The Fundamental Fysiks Group) has pointed out:
…every quantum system has both an ‘inside’ and an ‘outside’, and … consciousness
both in humans as well as in other sentient beings is identical to the inner experience of
some quantum system. A quantum system’s outside behavior is described by quantum
theory, it’s inside experience is the subject matter of a new ‘inner physics’….57
As Mensky indicates, the required ‘inner physics’ actually already exists within Buddhist
psycho-metaphysics. Consciousness is, then, the internal qualitative aspect of the quantum
functioning of the ‘ground of being’. According to Buddhist psycho-metaphysics a continuous
direct experience of the ground level of awareness is an experience of buddhahood, or
enlightenment:
When the true face of the ground aspect of buddhahood — a state of purity and mastery
of the ground of being … timeless awareness — the innate glow of the ground of being —
subside into an inner glow whose radiance is directed outwards …58
Advanced Buddhist meditation involves the dissolving of the dualistic everyday levels of the
functioning of consciousness and the activation of deeper levels of a more universal
consciousness. As Buddhist practitioner-writer B. Alan Wallace has pointed out:
This brings us to primordial consciousness, the ultimate level of mind that Buddhists
seek to penetrate. The substrate consciousness can be compared to a relative vacuum. It
is relatively empty, but still possesses structure and energy, characterized by such
attributes as bliss (spiritual joy or rapture), luminosity (an internal radiance), and a muted
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
29
sense of duality between subject and object. Primordial consciousness — characterized as
the absolute ground, the most basic state of consciousness — could then be characterized
as the absolute vacuum of consciousness. Like the absolute vacuum of modern physics, it
entails the lowest possible state of mental activity but the highest possible potential and
degree of freedom. Furthermore, whereas the substrate consciousness is conscious of the
substrate — the relative inner space or vacuum of the mind — primordial consciousness is
indivisibly aware of the absolute space of all phenomena (dharmadhatu), which is
beyond the duality of external and internal space. Out of this space emerge all the
phenomena that make up all worlds of experience — the whole universe, inside and out,
subjective and objective. All appearances of external and internal space, time, matter, and
consciousness emerge from the dharmadhatu and consist of nothing other than
configurations of this absolute or true vacuum.59

Furthermore, final buddhahood, or complete enlightenment with a continuous awareness of the
nondual ground of being, is the endpoint of the evolution and development of a sentient being.
Wheeler’s quantum conclusions were entirely consistent with Buddhist psycho-metaphysics. He
summarized his conclusions in his article ‘Thoughts on the Origin of Spacetime’ as follows:
In what medium does spacetime itself live and move and have its being? Is there any
other answer than to say that consciousness brings all of creation into being, as surely
as spacetime and matter brought conscious life into being? Is all this great world that
we see around us a work of imagination?60
Figure 3
In other words we must conceive of a ground level universal energy-awareness-potentiality, also
designated within Buddhism as shunyata, or emptiness (not nothingness) which, through the
medium of “spacetime and matter,” “creates” a manifested realm of individuated sentient beings
within the apparently material world in order to embody individuated consciousness. Through
this process the universe can explore and discover its own meaning (figure 3). Such a viewpoint
is suggested by the recent notion of a “self-explaining universe” that the physicist Paul Davies
has written about in his book The Goldilocks Enigma:
…a good case can be made that life and mind are fundamental physical phenomena,
and so must be incorporated into the overall cosmic scheme. One possible line of
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
30
evidence for the central role of mind comes from the way in which an act of
observation enters into quantum mechanics. It turns out that the observation process
conceals a subtle form of teleology.61
Such a universe would necessarily contain organisms that embody the capacity for cognition,
which is to say consciousness, precisely because the purpose of ‘self-explanation’, to use
Davies’ terminology, or self-cognition, is fundamental to the universe. It is part of the
“teleology” of the universe.
Quantum physics seems increasingly to point towards the operation of an infinitely fertile
universal “imagination,” to use Wheeler’s term, which can actually bring into being an
extraordinary appearance of a vast ‘material’ universe containing infinite varieties of
consciousness, all of which inhabit an individualized field of meaning-values. As physicist
David Bohm pointed out:
We can say that human meanings make a contribution to the cosmos, but we can also
say that the cosmos may be ordered according to a kind of ‘objective’ meaning. New
meanings may emerge in this overall order. That is we may say that meaning penetrates
the cosmos, or even what is beyond the cosmos. For example there are current theories
in physics that imply that the universe emerged from the ‘big bang’. In the earliest phase
there were no electrons, protons, neutrons, or other basic structures. None of the laws
that we know would have had any meaning. Even space and time in their present welldefined form would have had no meaning. All of this emerged from a very different
state of affairs. The proposal is that, as happens with human beings, this emergence
included the creative unfoldment of generalized meaning. 62
Each sentient being is an individualized structure of experiential meaning-values embodied
within individualised consciousness, each sentient being embodies a fundamental evolutionary
impetus to maximise the overall meaning value of the individualized meaning-matrix, the final
endpoint being enlightenment, wherein the limited awareness of a sentient being dissolves into
its universal source.
This dramatic psycho-metaphysical perspective is articulated within the Buddhist Dzogchen
tradition in texts such as You Are the Eyes of the World, composed by the remarkable fourteenth
century practitioner-yogi Longchenpa:
Listen, because all you beings of the three realms
Were made by me, the creativity of the universe,
You are my children, equal to me.
Because you and I are not separate,
I manifest in you.63
This “creativity of the universe” can be seen in what Paul Davies indicates as a quantum
“teleology,” an internal purpose, which brings into existence a vast field of individuated sentient
beings all of which partake of the infinite capacity of the ultimate source. According to
Longchenpa:
Out of the state of pure and total presence, the impetus for everything
From which come the five great elements whose very being is this state,
I, the creativity of the universe,
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
31
Arise as teacher, in five forms of pure and total presence.64

These “five teachers,” which are generated by the “creativity of the universe which fashions
everything,”65 are earth, water, fire, wind and space, in other words all the factors which make up
the material dualistic world of experience. And:
If I [the state of pure and total presence which is the creativity of the universe] did not
exist, you would not exist.
When you do not exist, the five teachers [i.e. the dualistic and material world of
experience] also do not come about…66
It is intriguing to compare these observations with some of Wheeler’s, such as:
Yes, oh universe, without you I would not have been able to come into being. Yet you,
great system, are made of phenomena; and every phenomena rests on an act of
observation. You could never even exist without elementary acts of registration such as
mine.67
What Wheeler refers to as the “imagination” of a primordial consciousness that “brings all of
creation into being,” corresponds precisely to Longchenpa’s “majestic creativity [of the universe]
which fashions everything.”68
According to another Buddhist Dzogchen philosopher:
In the human context, intelligence reaches into man’s life as his spirituality, constituting
itself as human subjectivity. The latter, therefore, is not an immutable essence; rather it
is a product of an overall evolutionary force moving in an optimizing direction, thereby
enabling the subject to transcend itself by overcoming its limited domains. This force is
felt as giving meaning to man’s life and is experienced as having existential
significance. 69
In the Buddhist Dzogchen worldview, which is fully in accord with modern physics, we have a
remarkable vision of the universe as a meaning-machine, or meaning-organism, using sentient
beings both as creative agents and also agents of transcendence reaching towards ever greater
vistas of universal meaning-values. This perspective indicates a universal directedness towards
ever more universal modes of experience within consciousness, the ultimate experience being
‘enlightenment’.
What is enlightenment? It is the direct nonconceptual understanding of the ground of Being by
the fundamental cognizant aspect of the ground of Being itself. In other words enlightenment
occurs when the ground of Being fully and directly and nonconceptually cognizes, comprehends
and understands its own nature through the agency of a sentient human being (assuming that
animals cannot become enlightened). This is brilliantly explained in the excellent Dzogchen text
Wonders of the Natural Mind by Tenzin Wangyal Rinpoche. The ground of Being is characterized
within Dzogchen as an ‘empty’ energy field of potentiality which has an internal spontaneous
cognizant quality. The field of potentiality is designated ‘emptiness’ and the internal spontaneous
cognizant quality is designated ‘luminosity’ or ‘clarity’. Tenzin Wangyal Rinpoche writes:
Who then understands emptiness? There is the self-understanding of emptiness by
emptiness itself, by the clarity aspect of emptiness that enables understanding by direct
perception. Understanding is not separate from emptiness. Emptiness understands itself
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
32
and illuminates itself, … Herein lies the inseparability of emptiness and clarity; selfunderstanding is self-clarity or self-awareness.70
In Mensky’s terminology we may say that within enlightenment the Alterverse has a direct and
full understanding of its own infinite capacity and nature. In Buddhist terminology this is the
“ultimate reality intuitive wisdom (dharmadhatu-jnana)”71 by which the dharmadhatu, the
ultimate space of phenomena – Mensky’s ‘quantum Alterverse’, directly cognizes its own nature.
This vision of enlightenment as the final aim of the process of reality, and the evolution of the
universe and sentient beings within it, is a natural endpoint of Wheeler’s quantum psychometaphysics. His self-perceiving universe graphic indicates that as the universe evolves the
degree and power of “observership” increases over time. The final and most complete act of
observership can only be the omniscient knowledge of the true nature of all phenomena.
In this context it is worth pointing out that the kind of ‘omniscience’ within enlightenment
suggested by Mensky, wherein an enlightened being has “access to the entire set of parallel
worlds,” which is the entire ‘Alterverse’, corresponds to what the Buddhist scholar Sara L.
McClintock calls “capacity omniscience”:
On this model, which we find articulated … by Vasubandhu, one may be omniscient in
the sense that one may attain an unlimited capacity to know whatever one wishes
simply by directing one’s attention to the object in question; omniscience is not a matter
of knowing all things simultaneously. According to this model, the Buddha may be
called “all-knowing” by virtue of the fact of his unlimited capacity to know any
knowable thing to which he directs his attention…72
One important aspect of this omniscient capacity is the ability to directly see the rebirth history
of any sentient being.
Such a view, that the process of evolution is directed towards an omniscient endpoint, has been
called by some the Final Anthropic Principle. Quantum researcher David Deutsch, who views
the universe as a vast quantum computer, has speculated that in the distant future mankind will
form a kind of supermind that will in some sense unite with the universe, forming a god-like
entity. He describes the Final Anthropic Principle:
In the final anthropic principle or if anything like an infinite amount of computation
taking place is going to be true, which I think is highly plausible one way or another,
then the universe is heading towards something that might be called omniscience. …
But yes, there’s something like that, the concept that we’ve found that is most like a
religious concept is providence. The fine-tuning of the universe, whatever it’s due to,
is very like providence. But again, the role that this providence plays in physics is
very different from the role that religious providence plays in religion, because in
religion providence is supposed to be an explanation for why things are as they are.
And that’s no good, because you’ve got to explain why providence did this and it just
makes matters worse not better. In thinking about fine-tuning and trying to explain it,
what we’re looking for is something that explains the fine-tuning. In other words,
providence is not a proposed solution, it’s an interesting problem, which is going to
be explained by something else, if at all.73
However, the notion that the universe is merely a computational machine is yet again a
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
33
manifestation of the materialist prejudice which seeks to undermine the notion that
consciousness is a primary and the fundamental driving force of the process of reality. As
Gyatrul Rinpoche has pointed out:
Today people tend to spend many hours working on computers rather than gaining the
inner quality of experiential realization. A computer may have a tremendous amount of
information loaded onto it, but we have yet to see a computer that has obtained
liberation or omniscience.74
It is the primordial consciousness of the process of reality that becomes omniscient of its own
nature with the ‘achievement’ of enlightenment by a sentient being.
Because, like many scientists, Deutsch has a mistrust of religious metaphysics he rejects the
obvious conclusion that the fundamental existence of a primordial field of non-individuated
awareness is a “providential” given. Just as we cannot go beyond the fact of the existence of the
eternal quantum fields underlying the process of reality, so too, we cannot go beyond the fact of
the “providential” existence of primordial awareness or nondual awareness-consciousness.
Deutsch’s perspective clearly strays into the realm of religion, and it seems to correspond in
essence with Buddhist perspectives and it also reiterates the psycho-metaphysical perspective of
the great twentieth century French Jesuit theologian Pierre Teilhard de Chardin who postulated
that the process of the universe was directed towards a collective omniscient endpoint he called
the “Omega Point.” In his book The Phenomenon of Man he wrote:
… evolution is an ascent towards consciousness… Therefore it should culminate
forwards in some sort of supreme consciousness. But must not that consciousness, if it
is to be supreme, contain in the highest degree what is the perfection of our
consciousness – the illuminating involution of the being upon itself.75
This notion that the “supreme consciousness” results when individuated consciousness directly
cognizes its own nature is remarkably close to the Buddhist view. However, de Chardin, similar
to Deutsch, suggested that the final endpoint of the process of the universe resides at a distant
future point in a super-personal universal collective consciousness:
The very centre of our consciousness, deeper than all its radii; that is the essence which
Omega, if it is to be truly Omega, must reclaim. And this essence is obviously not
something of which we can dispossess ourselves for the benefit of others as we might
give away a coat or pass on a torch. For we are the very flame of that torch. To
communicate itself, my ego must subsist through abandoning itself or the gift will fade
away. The conclusion is inevitable that the concentration of a conscious universe would
be unthinkable if it did not reassemble in itself all consciousnesses as well as all the
conscious; each particular consciousness remaining conscious of itself at the end of the
operation, and even … each particular consciousness becoming still more itself and thus
more clearly distinct the closer it gets to them in Omega76
.
According to the psycho-metaphysical perspective presented by de Chardin, then, the Omega
endpoint is one in which each individuated consciousness “abandons” its limited ego centered
perspective, and in so doing it both becomes more fully “still more itself” whilst at the same time
becoming co-extensive with all other consciousnesses. Whilst this view initially appears
consistent and coherent with Buddhist psycho-metaphysics, it is in fact far more akin to the
Hindu notion of a substantial universal self (Atman-Brahman). Buddhism, apart, perhaps, for the
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
34
Jonang school, denies such a substantialist-idealist point of view.
De Chardin referred to “the primacy accorded to the psychic and to thought in the stuff of the
universe.”77
The ultimate dependency upon consciousness of the apparently external material
world is also clearly indicated by physicist Wojciech Zurek when he writes that the: “ultimate
evidence for the choice of one alternative resides in our illusive “consciousness”.78 But Zurek
also tells us that at the level of the everyday world consciousness seems to have little impact.
Quantum experimentation has shown without question that at the level of a single quantum state
consciousness influences the ‘choice’ of which alternative reality comes into being. However, at
the same time it also appears that on the large scale of the structures of the everyday world
individuated consciousness has no choice, the material world seems to exist under its own
momentum. This apparently independent weight of the apparently ‘external’ world of
materiality is maintained, according to Zurek, by the phenomenon of ‘decoherence’. According
to Zurek there is a kind of quantum template of the material world which “advertises” itself by
producing a multitude of copies which are accessed by the conscious-nesses of all sentient
beings. He likens this vast ‘template’ as a quantum “advertising billboard” which “decoheres”
quantum states under its own momentum.
In his “quantum Darwinism” proposal Zurek suggests that the quantum “advertising billboard”
springs into existence advertising classical reality when quantum correlations become “robust
enough”:
The main idea of quantum Darwinism is that we almost never do any direct
measurement on anything … the environment acts as a witness, or as a communication
channel. … It is like a big advertising billboard, which floats multiple copies of the
information about our universe all over the place.79
In other words there is a kind of quantum ‘matrix’ of the classical ‘material’ world which has
become resistant to obliteration through the process of observation, it “floats” so many copies
of itself all over the quantum environment that it becomes the source of the apparent
‘objectivity’ of the classical world. Zurek explains the emergence of “objectivity” from
“intersubjectivity” to Gefter as follows:
My view of reality has to do with what philosophers call intersubjectivity. That’s what
quantum Darwinism is all about. Reality is what we agree on. In that sense it’s what’s
invariant. But that invariance – and hence, quantum reality – is not fundamental, it’s
emergent and approximate.80
And:
To understand objectivity. In a quantum universe we do not measure anything directly.
If I were to make a direct measurement of a system, I could disturb its state. But I
never do that, because usually the environment does the measuring for me. It decides
on the set of states that get found out and get disseminated, and I never interact with the
system directly, I just use the environment as a witness. The observer gets hold of the
information that is already advertised all over the place.81

In this discussion Zurek makes a distinction between the “advertising billboard,” which is the
quantum template of the universe that “floats” copies of itself “all over the place,” and the
environment which acts as a “communication channel” which conveys quantum information
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
35
about the template to observers. In this way the original “advertising billboard” does not get
disturbed. On this view, ‘decoherence’ is the way that the “advertising billboard” maintains
itself in the quantum environment and the “quantum Darwinism” extra is the notion of the
environment acting as a “witness” in conveying information to observers, as Zurek explains:
Quantum Darwinism goes beyond decoherence. It recognizes that we don’t measure
anything directly. We just find out from the environment.82
As Gefter points out, this view eliminates Wheeler’s notion of observer-dependency because the
maintenance of the “intersubjective” “objective” world becomes the responsibility of
decoherence, the “environment” then conveys the information to the observer, so the observer is
isolated from the quantum template of the material world. Zurek replies that:
Usually the measurement is done for you by the environment. But there are situations
in which you deal with quantum systems hands-on. In that case, the choice is up to you
how you want to set up your apparatus and decide what you’re going to measure.83
Thus it appears that Zurek erects a rigid division between the case wherein quantum experiments
are performed to demonstrate the “ultimate” dependency upon consciousness, and the case of the
everyday material world which appears, in this presentation, to be entirely independent of
consciousness. So Zurek’s viewpoint does indeed appear to undermine Wheeler’s “participatory
universe.” Although Zurek says that: “the Universe is quantum to the core,” he seems hell bent
on giving it a fully classical demeanor, by isolating his quantum “advertising billboard” from the
tampering effects of conscious observation.
Zurek’s approach, then, seems to eliminate the operation of consciousness. As John Campbell, in
his article Quantum Darwinism as a Darwinian process, says of Zurek’s work:
Hopefully this treatment will finally lay to rest the interpretational confusion around the
role of a human observer in quantum measurements that has been prevalent in many
treatments and taken to anthropomorphic extremes by some such as Wigner. Zurek’s
work makes it clear that decoherence takes place whenever there is an information
transfer to the environment. No human observer need be in attendance.84
Eugene Wigner was a quantum physicist who was entirely convinced of the necessity of the
quantum operation of consciousness:
When the province of physical theory was extended to encompass microscopic
phenomena, through the creation of quantum mechanics, the concept of
consciousness came to the fore again: it was not possible to formulate the laws of
quantum mechanics in a fully consistent way without reference to the consciousness.
All that quantum mechanics purports to provide are probability connections between
subsequent impressions (also called “apperceptions”) of the consciousness, and even
though the dividing line between the observer, whose consciousness is being
affected, and the observed physical object can be shifted towards the one or the other
to a considerable degree, it cannot be eliminated. It may be premature to believe that
the present philosophy of quantum mechanics will remain a permanent feature of
future physical theories; it will remain remarkable, in whatever way our future
concepts may develop, that the very study of the external world led to the conclusion
that the content of the consciousness is an ultimate reality.85
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
36
Campbell’s desperate rush to dismiss the efficacy of consciousness on the basis of Zurek’s
treatment is, however, mistaken. Zurek’s presentation is only a partial picture. Physicist Erich
Joos has pointed out:
Does decoherence solve the measurement problem? Clearly not. What decoherence tells
us, is that certain objects appear classical when they are observed. But what is an
observation? At some stage, we still have to apply the usual probability rules of quantum
theory.86
And Dieter Zeh:
Decoherence by itself does not yet solve the measurement problem … This argument is
nonetheless found widespread in the literature … It does seem that the measurement
problem can only be resolved if the Schrödinger dynamics … is supplemented by a
nonunitary collapse…87

Zurek’s account is deficient, it does not, for instance, address the issue of the probabilities within
quantum theory. And neither does it give an account of how the quantum “advertising billboard”
came into being. At the point of the big bang there was only a vast set of quantum possibilities
and no established “advertising billboard,” so where did it come from?
If Zurek really considers that his “view of reality has to do with what philosophers call
intersubjectivity” and “Reality is what we agree on,”88 then should not the “advertising
billboard” also be intersubjective in true Wheeler-type sense? However, apparently Wheeler had
problems reconciling himself with a quantum metaphysics which involved multiple observers.
The problem is highlighted by the quantum conundrum of “Wigner’s Friend,” a thought
experiment concocted by Wigner. If ‘Wigner’s friend’ collapses the wavefunction of an atom
inside a laboratory, then from the point of view of the friend both atom and friend are not in a
state of quantum superposition. But from Wigner’s point of view, standing outside the lab, both
atom and friend are in a state of quantum superposition. So it seems that when we look at the
situation involving multiple observers a contradiction arises. As Gefter writes:
Wigner took the paradox to mean that consciousness plays some special role in physics
– that while atoms and photographic plates … could be in superpositions, conscious
people could not.89

So Wheeler too was forced to accept a special role for consciousness. Gefter writes:
Wheeler was stuck. The only way to have multiple observers living in the same
universe without having to give up the observer’s ability to create reality was to afford
some special role for consciousness, however reluctant he was to do it. That opened up
a host of bizarre but unavoidable questions “What level of consciousness?” “Does a
worm qualify?” “What about household appliances?”90
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
37

Figure 4. Wigner’s friend
Gefter’s absurd quip about “household appliances” is irrelevant because they are not sentient
beings. Quips such as these simply indicate that the author has given up using coherent
reasoning and is resorting to attempted sarcasm. A worm, on the other hand, is a sentient being,
although the level of consciousness of such an organism is clearly very low, in fact its level is
likely to be virtually unconscious and automatic. This indicates a problem with Western
concepts of consciousness and unconsciousness when viewed from a Buddhist perspective. For
Buddhist psycho-metaphysics what the West calls the ‘unconscious’ is still a state of
consciousness, although it is not accompanied (usually) by self-awareness. Within Buddhist
psycho-metaphysics even dreamless sleep is a state of consciousness, it is the clear light mind.
For ordinary human beings this state is a state of blankness, but advanced Buddhist practitioners
can achieve self-awareness even within the clear light mind of deep sleep.
Gefter’s quip about the worm, which is clearly an attempt at irony which she thinks indicates the
silliness of the notion that consciousness has an important role in the creation of the universe,
can be easily defused. All sentient beings, even worms which have barely a glimmer of
sentience, are animated by the primordial consciousness of the process of reality. It is this
primordial consciousness which creates sentient beings and their environments and then acts
through sentient beings to maintain the universe and evolve the sentient beings within it towards
greater levels of self-awareness. The phenomenon of the ‘collapse of the wavefunction’ is not
necessarily evidence that all sentient beings are individually creating reality by beaming single
rays of consciousness, so to speak, at quantum wavefunctions, but, rather, it indicates that a deep
level of primordial consciousness is operating through the community of sentient beings of all
levels of consciousness in order to “create” the process of reality.
Thus the “intersubjective” creation of the universe is coherently coordinated by a deep level of
primordial consciousness. In this way primordial consciousness acts upon the quantum
potentialities in order to produce a coherent world of manifestation. This is the origin of Zurek’s
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
38
quantum “advertising billboard.” And from the point of view of individual sentient beings
individual consciousness has little individual impact upon the edifice of the apparently material
world precisely because it is an intersubjective collective creation generated by primordial
consciousness, eventually acting through the agency of all sentient beings. So, although Zurek is
correct when he says that “there is every indication that the choice occurs much before”
consciousness gets involved, this remark applies to individual consciousness. This does not
detract from the fact that ultimately primordial consciousness, acting through the collective
agency of sentient beings, orchestrates the process.
Gefter, however, is antagonistic to such notions:
Why drag consciousness into it all? I wondered. Wheeler knew it was a mystical
morass, and that one gap in understanding couldn’t be plugged by another. Observers,
sure – but why not stick with Einsteinian observers, just reference frames, coordinate
systems, rods and clocks? … the observer, conscious or not, had to be built out of
ordinary physics, not fairy dust.91
The answer to Gefter’s question about why Wheeler was drawn to the notion of the significance
of consciousness perhaps lies in the fact that Wheeler was probably aware that “reference frames,
coordinate systems, rods and clocks” are not the kind of things which are capable of observing,
observations require consciousness. As to the final “fairy dust” remark, the employment of
prejudicial language does not count as evidence or reasoning. What ultimately is “ordinary
physics?” It certainly is not the classical physics of ‘matter’. Quantum fields are immaterial
fields of potentiality, and evidence and reasoning indicates they are animated by a primordial
quantum consciousness.
The tactic of using insulting language rather than coherent argument has a hallowed tradition in
the materialist academic camp. It is possible that Gefter took inspiration for her use of the term
“fairy dust” from the ardent materialist Patricia Churchland who tried to pour scorn on the
Penrose-Hameroff proposal concerning consciousness and quantum coherence in brain
microtubules:
Pixie dust in the synapses is about as explanatorily powerful as quantum coherence in
the microtubules.92
However, evidence is now emerging that Penrose and Hameroff may be correct to some extent.93
Churchland, like many ardent materialists, seems to think that concocting insults, without
bothering with evidence and reasoning, against viewpoints they dislike constitutes an argument.
Gefter seems to have inherited this materialist trait.
Gefter interviews a few other significant physicists and philosophers, there is no need to cover all
of them. The crucial issue we are concerned with is Gefter’s treatment of the notion of the
significant role of consciousness in the creation of the dualistic world and her attitude, as well as
the attitude of some others, to the Anthropic Principle and religion. In the second chapter of TEL
she writes concerning the Physics and Ultimate Reality symposium that she gatecrashed, posing
as a science journalist, that:
Throughout the symposium. There had been a giant elephant in the room: the anthropic
principle. … Anthropic had become a four letter word because it veered uncomfortably
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
39
close to religion … as if the universe, somehow, were built just for us.94
Gefter has little patience with religion, she has pitched her intellectual tent with the anti-religion
materialist camp. Thus in a piece published in The New Scientist entitled “How to spot a hidden
religious agenda” she wrote:
As a book reviews editor at New Scientist, I often come across so-called science books
which after a few pages reveal themselves to be harbouring ulterior motives. I have
learned to recognise clues that the author is pushing a religious agenda. As creationists
in the US continue to lose court battles over attempts to have intelligent design taught
as science in federally funded schools, their strategy has been forced to… well, evolve.
That means ensuring that references to pseudoscientific concepts like ID are more
heavily veiled. So I thought I’d share a few tips for spotting what may be religion in
science’s clothing. Red flag number one: the term “scientific materialism”.
“Materialism” is most often used in contrast to something else – something nonmaterial, or supernatural. Proponents of ID frequently lament the scientific claim that
humans are the product of purely material forces. At the same time, they never define
how non-material forces might work. I have yet to find a definition that characterises
non-materialism by what it is, rather than by what it is not. The invocation of Cartesian
dualism – where the brain and mind are viewed as two distinct entities, one material and
the other immaterial – is also a red flag. And if an author describes the mind, or any
biological system for that matter, as “irreducibly complex”, let the alarm bells ring.
Misguided interpretations of quantum physics are a classic hallmark of pseudo-science,
usually of the New Age variety, but some religious groups are now appealing to aspects
of quantum weirdness to account for free will. Beware: this is nonsense.95
This passage clearly indicates Gefter’s antagonism to the Intelligent Design (ID) perspective and
her adherence to ‘scientific materialism’. But how does this endorsement of materialism sit with
her Trespassing (TEL) conclusion that:
The message was clear: having a finite frame of reference creates the illusion of a
world, but even the reference frame itself is an illusion. Observers create reality, but
observers aren’t real. There is nothing ontologically distinct about an observer, because
you can always find a frame in which that observer disappears…96

If adopting a “finite frame of reference creates the illusion of a world” then the apparent
‘material’ in that illusory world must also be illusory, so how can someone holding to such a
conclusion coherently preach a crude materialism, which asserts the ultimate ontological primacy
of ‘matter’, conceived of as independent extended ‘stuff’. Furthermore, how can “unreal”
observers create an “illusory,” and yet “material,” reality through the mechanism of their
observation without being endowed with consciousness? After all, Zurek and other significant
physicists state that the “ultimate” “choice” of quantum alternative realities resides within
consciousness? Gefter seems to preside over a remarkable morass of contradictory claims,
indicating a lack of awareness of logical coherence, or a lack of intellectual integrity. And yet
Gefter, as she proudly informs us, is the book reviews editor for New Scientist, and in this
position she attempts to pour scorn on non-materialist works.
Gefter says that “some religious groups are now appealing to aspects of quantum weirdness to
account for free will.” But there are also significant quantum physicists such as Mensky, Stapp,
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
40
Goswami and others who also claim this. In his paper entitled Free Will Stapp writes that:
A criterion for the existence of human free will is specified: a human action is asserted
to be a manifestation of human freewill if this action is a specific physical action that is
experienced as being consciously chosen and willed to occur by a human agent, and is
not determined within physical theory either in terms of the physically described aspects
of nature or by any non-human agency.97
And the paper then presents an account of how the “orthodox quantum mechanics that flows
from John von Neumann’s analysis of the process of measurement in quantum theory” leaves a
“causal gap” which is closed by the presence of free will. Stapp’s account is far from “New Age”
and is detailed and precise.
Stapp points out that the “orthodox quantum mechanics” that derives from John von Neumann’s
presentation of the process of measurement in quantum theory is in terms of three processes that
indicate a fundamental “three-level conception of reality.” Von Neumann’s “Process 2” is the
deterministic evolution of the probabilities of the quantum realm of idea-like potentiality, this is
described by the Schrödinger equation. “Process 1” is a “psychophysical probing action whose
psychologically described aspect is an increment in the knowledge of a probing agent/observer.”
“Process 3,” is “a choice on the part of nature,” which is a “response to such a probing action.”
In other words, in “Process 1” an experimenter or group of experimenters perform a “probing
action” by deciding upon and then setting up a quantum experiment which can have various
outcomes which have associated probabilities. Because the choice of experiment determines
what the possible outcomes can be, spin up-down or spin left-right for example, this probing
action determines what responses “nature” can give. When the experiment is performed “nature”
then makes a “choice,” and thereby the “probing knowledge-acquiring agents” get their
knowledge. This, Stapp says, constitutes “an idea-based quantum triality,” and:
…the dynamical structure of quantum theory contains certain causal gaps. In particular,
the process-1 agent-generated choices of probing actions are determined, within the
theory, neither by the physically described aspects of nature, nor by any non-human
agency. Thus, within the framework of orthodox quantum mechanics, the process-1
probing actions are, according to the specified criterion, manifestations of human free
will…98
Stapp has also pointed out that this situation applies not just in quantum experiments but also in
everyday life.

1 Sarfatti, Jack ‘Wheeler’s World: It From Bit?’ — Internet Science Education Project, San Francisco, CA.
2 Gefter, Amanda (2014), 281
3 Mensky (2010), 15
4
The Observer (January 25th, 1931)
5
https://www.kirkusreviews.com/book-reviews/amanda-gefter/trespassing-on-einsteins-lawn/
6
http://www.math.columbia.edu/~woit/wordpress/?p=6532
7
ibid
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
41

8 Baggott, Jim (2014), 2
9
http://plato.stanford.edu/entries/metaphysics/
10 Shimony, A. [1984] «Contextual Hidden Variables Theories and Bell’s Inequalities», Brit ish Journal for
Philosophy of Science 35: 25-45
11 Baggott, Jim (2014), x
12 Baggott, Jim (2014), 23
13 Penrose, Roger (1999) p295
14
Sarfatti , Jack ‘Wheeler’s World: It From Bit?’ — Internet Science Education Project, San Francisco,
CA..
15 Barrow, John D., Davies, Paul C. W., Harper, Charles L. (eds) (2004) p201 – Anton Zeilinger: ‘Why
the quantum? “It” from bit”? A participatory universe? Three far-reaching challenges from John
Archibald Wheeler and their relation to experiment.’
16
d’Espagnat, Bernard, ‘The Quantum Theory and Reality’ Scientific American, Nov. 197
17 Fred Hoyle, «The Universe: Past and Present Reflections.» Engineering and Science, November, 1981.
pp. 8–12
18 Barrow John D., Davies, Paul C. W., Harper, Charles L. (eds) (2004) p577 – Wheeler, J A (1999)
‘Information, physics, quantum: the search for links.’ In Feynman and Computation: Exploring the Limits
of Computers, ed A. J. G. Hey, p309 (314). Cambridge, MA: Perseus Books.
19 Bostrom, Nick, Anthropic Bias: Observation Selection Effects in Science and Philosophy, 6
20 Baggott, Jim (2014), 278
21 Baggott, Jim (2014), 23
22 Ibid.
23 Carter, 1974, p. 291 — Large number coincidences and the anthropic principle in cosmology. In:
Longair, M. (Ed.), Confrontation of Cosmological Theories with Observational Data. Reidel, Dordrecht,
pp. 291-298.
24 http://www.nybooks.com/articles/archives/1997/jan/09/billions-and-billions-of-demons/
25 Gefter, Amanda (2014), 21
26 Gefter, Amanda (2014), 209
27 Gefter, Amanda (2014), 281
28 Gefter, Amanda (2014), 44
29
Barrow, John D., Davies, Paul C. W., Harper, Charles L. (eds) (2004) p201 – Anton Zeilinger: ‘Why
the quantum? “It” from bit”? A participatory universe? Three far-reaching challenges from John
Archibald Wheeler and their relation to experiment.’
30 Rosenblum, Bruce and Kuttner, Fred (2006), 201
31 Gefter, Amanda (2014), 52
32 Gefter, Amanda (2014), 101
33 Wheeler, J, A, ‘Law Without Law’, 185 —
http://www.forizslaszlo.com/tudomany/wheeler_law_without_law.pdf
34 Ibid.
35 Wheeler, J., A., ‘Law Without Law’, 194
36 Wheeler, J., A., ‘Law Without Law’, 197
37 Wheeler, J., A., ‘Law Without Law’, 199
38 Ibid.
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
42

39 Wheeler, J., A., ‘Law Without Law’, 196
40 Rosenblum, Bruce and Kuttner, Fred (2006), 179
41 Rosenblum, Bruce and Kuttner, Fred (2006), 139
42
Kaiser, D (2011), 19-20
43
Kaiser, D (2011), 23
44
Kaiser, D (2011), 65
45
Kaiser, D (2011), 80
46
Wheeler, J., A., ‘Law Without Law’, 199
47 Gefter, Amanda (2014), 101
48
Wheeler, J., A., ‘Law Without Law’, 209
49 Ibid.
50 Gefter, Amanda (2014), 216
51 Gefter, Amanda (2014), 101
52 Barrow, John D., Davies, Paul C. W., Harper, Charles L. (eds.) (2004), 451
53 http://discovermagazine.com/2002/jun/featuniverse
54
Lingpa, Dudjom (2002), 95
55 Dalai Lama, Herbert Benson, Robert Thurman, Howard Gardner, Daniel Goleman (1999), 21
56 Mensky (2010), 12
57 Herbert, Nick: ‘Holistic Physics -or- Introduction to Quantum Tantra’ – Internet document
(www.southerncrossreview.org/16/herbert.essay.htm)
58 Lingpa, Dudjom (2002), 95
59 Wallace, B. Alan (2008) p192
60 http://adsabs.harvard.edu/abs/2003APS..APR.b6003W
61 Davies, Paul (2007), 275
62 Bohm, David (2003), 180
63 Longchenpa (2000,2010), 38
64 Longchenpa (2000,2010), 37
65 Longchenpa (2000,2010), 36
66 Longchenpa (2000,2010), 39
67 Wheeler, J., A., ‘Law Without Law’, 199
68 Longchenpa (2000,2010), 36
69 Guenther, Herbert V. (1984). 33
70 Wangyal, Tenzin Rinpoche (2000) p181
71 Thurman, Robert A. F. (1991), 71
72 McClintock Sara, L. (2010), 31
73 Deutsch, D., (2006) — http://www.abc.net.au/radionational/programs/scienceshow/the-anthropic-universe/3302686#transcript
74 Gyatrul Rinpoche (trans. Wallace, B. A.) (1998) 19
75 De Chardin, Pierre Teilhard (2008), 258
76 De Chardin, Pierre Teilhard (2008), 261
77 De Chardin, Pierre Teilhard (2008), 30
78 Zurek Wojciech H.(2002). ‘ Decoherence and the Transition from Quantum to Classical – Revisited’ in
Los Alamos Science Number 27 2002
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 12-43
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part I)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
43

79 ‘The Evolution of Reality’ – www.fqxi.org/community/articles/display/122 (The Foundational
Questions Institute) November 10, 2009.
80 Gefter, Amanda (2014), 227
81 Gefter, Amanda (2014), 224
82 Gefter, Amanda (2014), 222
83 Gefter, Amanda (2014), 225
84 Campbell, John, ‘Quantum Darwinism as a Darwinian Process’ —
http://arxiv.org/ftp/arxiv/papers/1001/1001.0745.pdf
85 Wigner, Eugene — ‘Remarks on the Mind-Body Question’, http://philpapers.org/rec/EUGWRO
86
Joos – quoted in — http://pilotscholars.up.edu/cgi/viewcontent.cgi?article=1011&context=phy_facpubs
87
Joos et al., 2003 Ch.2 – quoted in Schlosshauer, M., (ed.) (2011)
88 Gefter, Amanda (2014), 227
89 Gefter, Amanda (2014)
90 Gefter, Amanda (2014), 279-280
91 Gefter, Amanda (2014), 275
92 http://www.timeshighereducation.co.uk/features/does-consciousness-emerge-from-quantumprocesses/92981.article
93 http://www.sciencedaily.com/releases/2014/01/140116085105.htm
94 Gefter, Amanda (2014), 28-29
95 http://sciencenotes.wordpress.com/2009/03/15/amanda-gefter-how-to-spot-a-hidden-religious-agenda/
96 Gefter, Amanda (2014), 392
97 Stapp, H. – ‘Free Will’ — http://www-physics.lbl.gov/~stapp/FW.pdf
98 Ibid.
(Continued on Part II)
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
44
Article
Why S?
Trespassing on an Anthropic Lawn (Part II)
Graham P. Smetham*
ABSTRACT
Mindful reflections upon a metaphysically misguided materialist advertising campaign:
Trespassing on Einstein’s Lawn: A Father, a Daughter, the Meaning of Nothing, and the
Beginning of Everything by Amanda Gefter. Gefter, New Scientist book reviews editor, presents
a philosophically confused account of current quantum metaphysics because she adheres to an
out of date materialist metaphysics and claims that, whilst observers in some way create reality,
the process does not involve consciousness. Her claims are shown to invalid, the various
quantum metaphysical perspectives she covers are shown to require consciousness as
fundamental.
Keywords: Grand design, observers, consciousness, anthropic principle, Darwinism,
evolutionary developmental biology, Cambrian explosion, quantum morphogenetic archetypes,
buddhanature, nothingness, emptiness, primordial consciousness, timeless awareness, substrate of
consciousness.
(Continued from Part I)
Mensky’s account of quantum “free will” indicates that, because consciousness is a quantum
field phenomenon associated with the “separation of alternatives,” in some circumstances an
individual mind can be in ‘two minds’. This situation arises when the individual quantum state
of consciousness is in a superposition of possibilities with equal, or close to equal, probability
weightings. In this situation it is natural to suppose that an individuated consciousness could
have a direct, but constrained, effect upon the alternative possibilities for action:
If I wish to go to the right and actually go to the right, how (does) this happen? … In
the framework of EEC [Extended Everett Concept], if the modification of probabilities
is assumed, free will is explained quite naturally. There are two alternatives: in one (of)
Everett’s world(s) I go to the right, in the other I go to the left. Both alternatives have
non-zero probabilities. My consciousness modifies the probabilities, increasing the
probability of the first alternative. As a result, with a high probability I go to the right.
This is my free will.1
Dismissing such evidence-based reasoned accounts of a quantum basis for free will by simply
resorting to intellectual abuse will not do, “a book reviews editor at New Scientist” should know
better.

  • Correspondence: Graham Smetham http://www.quantumbuddhism.com E-mail:graham@quantumbuddhsim.com
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
    Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
    ISSN: 2159-046X DNA Decipher Journal
    Published by QuantumDream, Inc.
    www.dnadecipher.com
    45
    It is worth noting that Stapp, like Wheeler and others, endorses the Anthropic Principle. When, in
    an interview, Stapp was asked:
    John Archibald Wheeler and John Barrow and Frank Tipler felt that human beings were
    vital components within the cosmic order. Would you agree with the Anthropic
    Principle, that humans were brought into existence by the universe to observe it?
    He replied:
    Not merely to passively observe it, but to contribute to the actual unfolding of the
    actual.
    And later in this conversation Stapp says: “I do not believe the reality of which we are parts is an
    accident!”2
    Some, perhaps, might want to call Goswami’s view on the issue of free will as approaching a
    “New Age” perspective, but does that really make it invalid? According to Goswami:
    What materialists say fundamentally is that we do not have free will to choose; we are
    just products of Newtonian determinism and in addition Darwinian determinism.
    Evolution has given us brain circuits, and we are helpless before them. What the
    spiritual tradition says, that while we have this negative emotional brain circuit of
    competitiveness, greed, jealousy, anger, and what have you; we also, by listening to this
    power of downward causation and acting on them; we can create our reality in which
    we make positive emotions for ourselves and in our relationships; and we can create
    positive emotional brain circuits that will then mollify the negative emotional brain
    circuit; and so we can overcome our base desires.3
    As with some other epithets employed by Gefter, the use of the term “New Age” is little more
    than a term of abuse, as usual Gefter does not use evidence or reason when dealing with nonmaterialist viewpoints. The crucial point here is that Goswami is talking about the way in which
    the brain can be rewired through the development of new habits and attitudes. This has been
    scientifically demonstrated in the work of scientists like Dr. Jeffrey Schwartz, an associate of
    Stapp, who treats obsessive compulsive disorder:
    Schwartz says mainstream science has yet to come to grips with … what Schwartz calls
    “self-directed neuroplasticity,” the ability to rewire your brain with your thoughts. This
    kind of power doesn’t only rescue his patients, he says. It rescues free will.4
    It seems, however, that Gefter is not worried about her negative habit of not bothering to
    investigate such evidence, she simply uses her position as a reviewer to reiterate mistaken
    materialist dogma.
    The reality of free will, of course is crucial for any spiritual perspective, because the decision to
    embark on a spiritual “path to enlightenment” requires a free-willed decision and subsequent
    free-willed ethical and spiritual choices, often in the face of opposing desires. But it is important
    to understand that free will has limits. As Kyabje Kalu Rinpoche indicates:
    It is very important to understand clearly that although karma conditions our
    experiences and actions, we still enjoy a certain measure of freedom – what would be
    called free will in the West – which is always present in us in varying proportions.5
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
    Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
    ISSN: 2159-046X DNA Decipher Journal
    Published by QuantumDream, Inc.
    www.dnadecipher.com
    46
    Karma-vipaka, cause and effect, is the Buddhist technical term for the mechanism by which
    actions (karma), leave traces of potentiality which may be triggered to produce effects or
    perceptions of the same or similar kind at a future point in time (vipaka).
    The quantum universe is a quantum-karmic universe because, as Stapp has pointed out, the
    quantum universe is “a universe populated by allowed possible physical actions and possible
    experienced feedbacks from such actions.”6
    Even the appearance of the apparently material
    world is a karmic appearance because it has been created over vast time periods by the
    perceptions of uncountable numbers of sentient beings. Such a view is entirely consistent with
    the quantum perspectives we have been investigating. It follows, therefore, that the great
    majority of the conditions experienced by any human being are not under their control. This
    much is obvious and to be expected. Although the material world is ‘created’ by a quantum
    “epiontic” process and therefore is a product of the fundamental ground of quantum ‘dream
    stuff’, at the point of evolution wherein the containing world solidifies to the extent that it
    currently has, it functions pretty much like a classically material world. Normal sentient beings
    cannot walk through walls.
    As we have seen, Gefter generally offers no reasoned refutations of opposing accounts, she uses
    prejudicial descriptions: “nonsense,” “bullshit,” “fairy dust,” and so on in her attempted
    debunking of the significance of consciousness. She suggests that the only alternative to
    materialism is the supernatural, but the quantum realm, which Zurek tells us is comprised of
    “epiontic” (epistemology creates ontology) “dream stuff,” is immaterial and yet not
    “supernatural.” She claims that she is “yet to find a definition that characterises non-materialism
    by what it is, rather than by what it is not.” This indicates that she has not looked very far,
    because Mensky, Stapp, Goswami and some others have produced detailed quantum-psychometaphysical accounts of exactly this. She also says that proponents of ID, and both Mensky and
    Stapp present quantum-psycho-metaphysical accounts consistent with ID, and Goswami is a
    committed proponent of ID against materialist Darwinism, “never define how non-material
    forces might work,” but Mensky, Stapp and Goswami and others have presented very detailed
    accounts of how consciousness functions to unfold quantum potentialities, as has Hawking &
    Mlodinow. The latter have cogently argued the case for the Strong Anthropic Principle:
    The weak anthropic principle is not very controversial. But there is a stronger form that
    we will argue for here, although it is regarded with disdain among some physicists. The
    strong anthropic principle suggests that the fact that we exist imposes constraints not
    just on our environment but on the possible form and content of the laws of nature
    themselves. The idea arose because it is not only the peculiar characteristics of our solar
    system that seem oddly conducive to the development of human life but also the
    characteristics of our entire universe, and that is much more difficult to explain.7
    And a crucial chapter of their book is entitled ‘Choosing Our Universe’ in which they describe
    how the collective consciousness of all sentient beings chooses, over time and backwards in
    time, which of the alternative universes to inhabit.
    Gefter indicates her materialist leanings, at the same time as inconsistently holding to a radical
    conclusion of an “observer-created reality,” by her support for the professional “debunker” of
    quantum-spiritual perspectives Victor Stenger. In his excellent article concerning Victor
    Stenger’s book Quantum Gods: Creation, Chaos and the Search for Cosmic Consciousness,
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
    Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
    ISSN: 2159-046X DNA Decipher Journal
    Published by QuantumDream, Inc.
    www.dnadecipher.com
    47
    physicist and philosopher David Scharf writes in his abstract:
    Quantum spirituality—the idea that some aspect of consciousness plays a fundamental
    role in the universe and that advanced physics should be interpreted as having to some
    extent already incorporated this principle—has had distinguished representation among
    both physicists and philosophers. It has generated an upsurge of grass-roots enthusiasm
    because of the widespread sense that science and spirituality, rather than being
    fundamentally separate or even opposed, are in fact deeply connected and mutually
    reinforcing. Victor Stenger’s purpose in writing Quantum Gods: Creation, Chaos, and
    the Search for Cosmic Consciousness is to “debunk” this idea—but attention to the
    details shows that it is actually Stenger’s arguments that need the debunking.
    Stenger—a retired physicist who is leveraging his scientific background to try to
    discredit anything and everything that smacks of spirituality—doesn’t respect his
    intellectual opponents enough to get their positions right; in some instances he appears
    to deliberately misrepresent their views; and, most important, his own reasoning is
    characterized by unremitting carelessness. Moreover, there is a method to his
    carelessness—it enables him to systematically avoid addressing the tough arguments of
    his opponents. Hence we find him frequently setting up a straw man by misrepresenting
    the debate as a simple matter of science and reason versus superstition. Once having
    defined this as the issue, all he needs to do is assume the attitude of an outraged
    scientist and heap on the ridicule. But if he had done his homework and taken the
    trouble to really understand the science and logic supporting quantum spirituality, he
    would have discovered that it is harder to dismiss than he had imagined. Indeed, the
    more carefully—and yes, critically—one considers the issues, the more one finds
    quantum spirituality to be eminently worthy of serious consideration, as a plausible and
    measured approach to the most long-standing and intractable questions at the basis of
    science.
    To anyone familiar with the physics and philosophical issues involved it is clear that Stenger’s
    work is a morass of misdirection, misinformation, misrepresentation and misleading claims.
    Scharf, however, is an adherent of Transcendental Meditation so is an interested party and might
    be thought to have an ‘agenda’, and for this reason he quickly points us to the philosopher
    Gordon McCabe’s views on Stenger’s work, precisely because McCabe is not an adherent, but
    rather an opponent, of the ‘quantum consciousness’ or ‘quantum spirituality-mysticism’
    perspective. McCabe writes:
    Whilst Stenger is correct to debunk this type of quantum mysticism, there seems little
    evidence that he has a knowledge of either philosophy or the philosophy of science, and
    this complacency leads him into error. … [Stenger] … demonstrates an ignorance of the
    relevant literature in the philosophy of physics … The principles of scholarship dictate
    that a professional researcher should be acquainted with all of the relevant literature
    before putting pen to paper, yet Stenger, and for that matter, most of the physicists who
    write about philosophical subjects, do so with a blithe disregard for this principle.
    Curious.8
    McCabe, however, is himself a materialist who believes that, although “a formal theory of the
    mind doesn’t exist as yet,” he can, in spite of the lack of evidence or theory, be sure that:
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
    Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
    ISSN: 2159-046X DNA Decipher Journal
    Published by QuantumDream, Inc.
    www.dnadecipher.com
    48
    … the mind supervenes upon the brain, and not vice-versa. Arguably, it is precisely this
    asymmetry which suggests that the mind reduces to, or emerges from the brain…9

One has to wonder about McCabe’s philosophical abilities, the employment of a pseudophilosophical term – ‘supervenes’ – does not cover over the fact that material ‘stuff’ defined to
have no glimmer or trace of potentiality for consciousness, which is the ‘stuff’ of mainstream
materialism, cannot, by definition and logical coherence, give rise to consciousness. So it is
clear that McCabe, who is supposed to be a professional philosopher, is also a stranger to logical
coherence.
Scharf points out that Stenger’s books:
… generally get enthusiastic reviews by the “new atheist” crowd, including such likeminded writers as Richard Dawkins, Christopher Hitchins, Sam Harris, and Michael
Shermer. Shermer’s foreword establishes the polemical tone for the book with its
provocative title, “Quantum Flapdoodle and Other Flummery.” This foreword refers to
“quantum flapdoodle” or “flapdoodlists” four times in four pages, with “New Age
nuttiness,” “airy fairy deity” and “pseudoscience” thrown in, to make sure we get the
point.10
So we are again clearly in the midst of the materialist penchant for the use of insults rather than
reason.
Scharf’s article is available online11 so there is no reason to outline it in detail, a couple of points
will suffice to get a taste. Stenger claims that Goswami’s Hindu Vedanta viewpoint is solipsism,
which is the view that only one individual mind exists. However, Vedanta is not solipsism
because it asserts the existence of a layer of nondual universal consciousness which divides
itself into the multitude of individual consciousnesses. So Stenger clearly misrepresents
Goswami. Scharf also points out Stenger’s astonishing lack of philosophical understanding,
Scharf writes:
In Western thought the primacy of consciousness has had many distinguished
representatives, including Plato, Leibniz, Immanuel Kant, Hume, George Berkeley,
Hegel, Schopenhauer and Edmund Husserl. In one of the simplest presentations, called
idealism, George Berkeley proposed that all material objects exist and interact in
consciousness; ultimately they are all ideas in the mind of God. In response, in what
must be one of the most famous non-sequiturs in Western philosophy, Samuel Johnson
kicked a stone and proclaimed, “I refute [Berkeley] thus!” But, from Berkeley’s point of
view, Samuel Johnson, the stone and the laws of nature governing their interaction are
all embedded in consciousness; so Johnson simply failed to understand the implications
of idealism. What’s worrisome in the present context is that Stenger also fails to
understand the implications, or to consider them in a serious or thoughtful manner:
I will not take seriously the idealist view that there is only spirit. Samuel
Johnson quickly refuted that by kicking a rock. The rock kicked back. (p.64)12
The last passage is a quote from Stenger. The important point is, of course, that the kicking of
the stone proves absolutely nothing, for Berkeley it is all, stone, Dr. Johnson and his foot, a
matter of consciousness, so to speak. This complete lack of philosophical understanding
indicates that Stenger is either pretending to be philosophically incompetent, or really is
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
49
philosophically incompetent.
Stenger also disregards or misrepresents the views of other physicists, as well as philosophers of
mind, and presents his own simplistic views as incontrovertible. Thus he asserts that all
phenomena can be reduced to the movement of material particles. This view, of course, does not
fit with quantum field theory. Scharf observes that:
But consciousness is the phenomenon most resistant to a reductive analysis. Today,
most philosophers of mind (even those sympathetic to the materialist perspective) have
abandoned a fully reductive approach and believe that, even supposing neuroscience
will someday provide an exhaustive account of all neurophysiological processes in the
brain, consciousness will remain unaccounted for. In other words, consciousness—what
it is like to have subjective experience—seems to be irreducible to neurophysiology.
Most contemporary discussions in the philosophy of mind acknowledge “the hard
problem of consciousness” (Chalmers, 1996), according to which the fact of
consciousness will remain unexplained even if—and this is a big if—all the functional
capacities of the mind could be accounted for in terms of neurophysiological processes.
Even Jaegwon Kim, regarded as a leading advocate of a hardcore materialist perspective
of mind, has backed away from a fully reductionist approach.13
And Stenger’s attitude to the phenomenon of quantum entanglement, which Schrödinger
considered the “central mystery of quantum physics,” is breathtakingly ridiculous. The EPR, or
Einstein-Podolsky-Rosen experiment demonstrates quantum entanglement and non-locality,
which is the fact of instantaneous quantum interconnection between non-local, or extremely
separated, quantum ‘particles’. Stenger writes that:
The EPR experiment results are widely discussed in the literature of quantum
spiritualism. Physicists, on the other hand, are underwhelmed. Quantum mechanics has
passed yet another empirical test. Ho hum.14

This is simply not true. As Scharf points out:
…the distinguished physicist David Mermin refers to this as the “sublime mystery of
quantum mechanics.”15
And physicist Brian Greene has remarked that:
Numerous assaults on our conception of reality are emerging from modern physics …
But of those that have been experimentally verified, I find none more mind-boggling
than the recent realisation that our universe is not local.16
And in a recent book the significant physicist Leonard Susskind writes that:
Einstein pointed to something so deep, so counterintuitive, so troubling, and yet so
exciting, that at the beginning of the twenty-first century to fascinate theoretical
physicists. … The phenomenon of entanglement is the essential fact of quantum
mechanics, the fact that makes it so different from classical physics. It brings into
question our entire understanding about what is real in the physical world.17
So Stenger’s claim that physicists are “underwhelmed” is clearly a falsehood.
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
50
Scharf indicates that Gefter is incapable of seeing into Stenger’s methodology because of her
own materialist worldview. According to Scharf, Stenger made an incorrect claim that the
Maharishi Mahesh Yogi claimed that his transcendental field was the same as the SU(5) grand
unification, this, apparently, was not the case. Scharf writes:
… since SU(5) is a discredited theory, a reader who doesn’t know any better might get
the impression that Maharishi’s ideas are tied to discredited science. And, in fact, this is
just the impression he gave the hapless New Scientist editor Amanda Gefter. Thus she
confidently declared in her enthusiastic—“with Stenger in charge … we are on sure
ground”— review of Quantum Gods:
Maharishi claimed that transcendental meditation gave practitioners access to the
“quantum field of cosmic consciousness.” This, he said, was identical to SU(5), the
model physicists were then investigating in their search for a grand unified theory.
Sadly for cosmic consciousness, real experiments later falsified SU(5).
Nice zinger, Amanda, but the falsification of SU(5) has nothing to do with Maharishi.
With Stenger in charge, the spread of misinformation is hard to keep up with!18
In his conclusion Scharf writes that:
A fundamental and recurring shortcoming of Quantum Gods has to do with the fact that
Stenger really doesn’t think the point-of-view of his intellectual adversaries is worth
taking the trouble to understand and get right. In order to properly evaluate Quantum
Gods it is important to realize that Stenger is not trying to contribute to the debate—he
is trying to shut off debate. He is setting a belligerent tenor, intended to put anyone on
the defensive who dares to suggest that quantum spirituality might deserve thoughtful
consideration. Indeed, at least two science magazine editors—Michael Shermer and
Amanda Gefter—have readily adopted Stenger’s tone and, insofar as they can influence
the editorial policies of their journals, they will see to it that no articles taking these
issues seriously see the light of day. In the history of science this is the way a prevailing
paradigm can obstruct scientific progress, hanging on long after it has served any useful
intellectual purpose.19
Indeed!
In her article ‘How to spot a hidden religious agenda’ Gefter writes of James Le Fanu’s book
Why Us? How Science Rediscovered the Mystery of Ourselves:
Some general sentiments are also red flags. Authors with religious motives make
shameless appeals to common sense, from the staid — “There is nothing we can be more
certain of than the reality of our sense of self” (James Le Fanu in Why Us?) … It is
crucial to the public’s intellectual health to know when science really is science. Those
with a religious agenda will continue to disguise their true views in their effort to win
supporters, so please read between the lines.20

How and why Gefter concludes that Le Fanu’s remark is either “shameless” or “religious” is a
mystery. Le Fanu’s claim looks more like a variation on Descartes’ certainty of his own
existence. Gefter, however, wants to paint Le Fanu as a dangerous and “shameless” fellow with
nefarious “religious motives” because of his arguments against materialism and crude materialist
Darwinism, and these are perspectives which she is, inconsistently, a champion of. However, as
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
51
we shall see, Le Fanu’s arguments are worth taking seriously and should not be dismissed out of
hand on the basis of Gefter’s shameless and crude materialist motives.
Le Fanu begins his exposition by indicating that we live in an age of scientific materialism, or
scientism, which is simply the dogmatic assertion that all scientific explanations must be in
terms of material causes. Le Fanu focuses on two paradigm examples of scientific materialism
exemplified by the so-called Decade of the Brain and the Human Genome Project. Le Fanu
writes regarding the supposition that scientific materialism has no limits to its explanatory
power:
The genome project and the Decade of the Brain represent the logical conclusion of that
supposition. First, the genome projects were predicated on the assumption that
unravelling the Double Helix would reveal ‘the secret of life’, as if a string of
chemicals could possibly account for the vast sweep of qualities of the wonders of the
living world; and, second, the assumption of the Decade of the Brain that … brain
scanning techniques would explain the mind, as if there could be any equivalence
between the electrical firing of neurons and the limitless richness of the internal
landscape of human memory, thought and action.21

Here Le Fanu highlights the simple logical impossibility of the supposed non-qualitative
independent ‘stuff’ of ‘matter’ magically turning into an entirely alien sphere of the qualitative
realm of awareness and experience. As long as matter is defined to be ‘stuff’ that is entirely
devoid of a qualitative dimension of awareness, as it is and always has been, such a
transformation is a logical impossibility, although, as we have seen, materialist apologists
regularly ignore logical coherence and simply assume that ‘matter’ can achieve the impossible
and materialize consciousness!
One of the central issues that Le Fanu addresses is that of the issue of the origin of order, and
this means that he is asking about the origin of design. A central issue, then, is that of intelligent
design (ID). One thing that needs to be pointed out immediately is that in the materialist camp
the ID perspective is generally identified with Creationism, which is the assertion that some kind
of independent ‘God’ in some way created the universe. However, it is perfectly possible to have
a non-theistic ID proposal. Mensky’s quantum-psycho-metaphysical account, which asserts the
presence of a Life-Principle involving consciousness unfolding quantum potentialities, is an
example. And, as we have seen, the Hawking-Mlodinow (H&M) quantum psycho-metaphysical
account presented in their book The Grand Design, which in essence is similar to Mensky’s
account, is also a version of a non-theistic intelligent design quantum psycho-metaphysics.
H&M tell us that the universe starts off “in every possible way,” this means that all possible
histories of the future development and evolution of the universe, including the organisms and
the relationships between organisms and other organisms, and relationships between organisms
and their environment, ‘exist’ as quantum potentialities at the dawn of time. In the H&M
quantum psycho-metaphysical model the history for our universe is chosen over time and
backwards in time by the collective consciousness of all sentient beings inhabiting the universe
through time. This means that, if anything like the H&M quantum-metaphysical model, or
Menky’s or Stapp’s, is correct then the absurd claims of materialist Darwinists, such as hippolike creatures taking to the sea and then transforming, millimetre by painful millimetre, into
whales, are clearly and irrefutably seen to be false. It must rather be the case that the patterns for
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
52
organic life are potential within underlying quantum fields.
Materialists such as Gefter talk about some kind of creation from ‘nothing’ or ‘nothingness’, but
such talk is conceptually confused and does not conform to the evidence that the eternal
backdrop to the process of reality is provided by quantum fields. As the physicist Lisa Randall
tells us:
Quantum field theory, the tool with which we study particles, is based upon eternal,
omnipresent objects that can create and destroy those particles. These objects are the
“fields” of quantum field theory. … quantum fields are objects that permeate spacetime
… they create or absorb elementary particles … particles can be produced or destroyed
anywhere at any time.22
The universe did not start off from ‘nothing’, it began as a quantum fluctuation in an eternally
present quantum field of potentiality. As Vlatko Vedral in his book Decoding Reality asserts:
The universe starts empty but potentially with a huge amount of information. The first
key event is the first act of symmetry breaking…23
In this context it is worth briefly examining a controversy which was prompted by the claim by
the physicist Lawrence Krauss, in his book A Universe From Nothing: Why There Is Something
Rather Than Nothing, that the entire universe could have emerged from “nothing.” By “nothing”
Krauss is referring to quantum field theory. The physicist and philosopher of science David
Albert rightly took Krauss to task for claiming that quantum fields are “nothing.” Albert wrote in
a New York Times Review of the book:
The particular, eternally persisting, elementary physical stuff of the world, according to
the standard presentations of relativistic quantum field theories, consists (unsurprisingly)
of relativistic quantum fields. And the fundamental laws of this theory take the form of
rules concerning which arrangements of those fields are physically possible and which
aren’t, and rules connecting the arrangements of those fields at later times to their
arrangements at earlier times, and so on — and they have nothing whatsoever to say on
the subject of where those fields came from, or of why the world should have consisted
of the particular kinds of fields it does, or of why it should have consisted of fields at all,
or of why there should have been a world in the first place. Period. Case closed. End of
story. … Relativistic-quantum-field-theoretical vacuum states — no less than giraffes or
refrigerators or solar systems — are particular arrangements of elementary physical
stuff. The true relativistic-quantum-field-theoretical equivalent to there not being any
physical stuff at all isn’t this or that particular arrangement of the fields — what it is
(obviously, and ineluctably, and on the contrary) is the simple absence of the fields! 24
‘Eternal’ quantum fields are quite clearly not ‘nothings’ but are fields of potentiality for
universes containing sentient beings to come into being. Such fields, which are immaterial
fields of potentiality that are ‘empty’ of substantiality have a remarkable resonance with the
Buddhist concept of emptiness – shunyata.
In his book Life Without Genes the biologist Adrian Woolfson endorses this viewpoint:
In the beginning there was mathematical possibility. At the very inception of the
universe fifteen billion years ago, a deep infinite-dimensional sea emerged from
nothingness. Its colourless waters, green and turquoise blue, glistened in the non-
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
53
existent light of the non-existent sun … A strange sea though, this information sea.
Strange because it was devoid of location …25
Ignoring the apparently endemic misguided notion that a vast realm of the process of reality and
experience can magically arise from complete “nothingness,” Woolfson’s suggestion is that there
is a quantum field of potentiality at the inception of the universe. This quantum field of
potentiality contains: “…all possible histories … through which the universe could have evolved
to its present state…”26 In the beginning, of course, the quantum potentiality field of the universe
contains all future evolutionary possibilities: “The information sea is thus a quantum mechanical
sea, composed from infinite repertoires of entangled quantum descriptions.”27 From out of the
vast entangled web of infinite possibilities for manifestation only certain potentialities will
actually make it into reality, so to speak: “An information space of this sort would furnish a
complete description of all potentially living and unrealizable creatures…28
It therefore follows
that there is a “design” woven into the potentialities for evolution; it is a vast complex design of
all possible manifestations for organic life written into the quantum field of potentiality. This
design, however, is not evidence of a ‘Creator’ because it is a design written into the
potentialities of the quantum ground of reality. Woolfson’s suggestion, of course, matches that
proposed by Hawking and Mlodinow, and is consistent with Mensky’s perspective.
The quantum psycho-metaphysical account, shared by Woolfson, H&M, Mensky, Stapp and
others, indicates a new worldview, based on the latest findings of quantum physics, a worldview
antithetical to the current ridiculous and dogmatic materialist Darwinian account of evolution. It
should not come as a surprise, then, that a great many modern discoveries within the biological
sciences, such as the evolutionary-development (‘Evo-Devo’) revolution, epigenetics and the
discovery of non-random directed mutation,29 are now clearly indicating the completely
ridiculous nature of the claims of crude materialist Darwinism. It is absolutely incomprehensible
that anyone could hold to what, given what we now know about the deep levels of quantum
reality, not to mention the discoveries of evolutionary-developmental biology, that any serious
scientist or philosopher would hold such a childishly simplistic world-view, and yet it still
remains a central dogma in Western intellectual and academic life. This desperate adherence to a
completely nonsensical worldview derives from the equally desperate clinging to a materialist
metaphysics which is motivated in large part by a determination not to allow “a Divine Foot in
the door” as Richard Lewontin puts it.
The quantum psycho-metaphysical requirement that the structure of the organic world exists in
some form as structures of potentiality within deep quantum levels of reality is consistent with
viewpoints concerning the origin of organic forms that prevailed prior to the Darwinian highjack
of academic biology. As Le Fanu points out, at the beginning of the nineteenth century the
“presiding genius of natural history” was Baron Georges Cuvier who:
…proposed two laws of … ‘formative impulse’, the laws of similarity (homology) and
correlation. First homology, Cuvier inferred from a detailed study of the ten thousand
specimens in his collection that diverse forms of animals concealed an underlying
‘unity of type’, the paddle of a porpoise, the horse’s legs and the human forearm were
all constructed from the same bones, adapted to their ‘way of life’ – whether flying or
swimming, running or grasping. His second law, of ‘correlation’, asserted that the
various parts of every animal … all correlated together, being so fashioned as to fulfil
its way of life.30
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
54
Cuvier’s notion of a natural ‘formative impulse’ can be thought of as a forerunner of Mensky’s
‘Life-Principle.’ Cuvier believed that all organisms must be considered to be functionally
integrated wholes, wherein all parts were interdependent. Therefore it was not possible for one
part of the structure to change over time whilst the rest remained static, changes to one part of an
organism’s structure over time would entail repercussions to its integrated system. If an
organism’s structure were to somehow transform piecemeal and slowly, as his contemporaries
Lamarck and Geoffroy Saint-Hilaire suggested, it wouldn’t survive in its environment. Cuvier
therefore opposed the notion of species changing into new species and suggested a deep level of
typological organic forms underlying the species. Of course, Cuvier could not have any idea that
the structural similarities and correlations of organic forms are the result of the activation of a
sequence of layered structural levels of quantum morphogenetic templates.
Darwin, of course, later asserted that evolution was the result of random variation and natural
selection acting gradually over very long time scales. The American philosopher and cognitive
scientist Jerry Fodor gives the following summary of the NS (natural selection) ‘adaptationist’
perspective which is the modern derivative of Darwin’s proposal:
Darwin’s theory of evolution has two parts. One is its familiar historical account of our
phylogeny; the other is the theory of natural selection, which purports to characterise the
mechanism not just of the formation of species, but of all evolutionary changes in the
innate properties of organisms. According to selection theory, a creature’s ‘phenotype’ –
the inventory of its heritable traits … is an adaptation to the demands of its ecological
situation. Adaptation is a name for the process by which environmental variables select
among the creatures in a population the ones whose heritable properties are most fit for
survival and reproduction. So environmental selection for fitness is (perhaps plus or
minus a bit) the process par excellence that prunes the evolutionary tree.31
In his book What Darwin Got Wrong Fodor (with Massimo Piattelli-Palmarini) refers to these
two components as “the genealogy of the species” (GS), which is the recognition of the historical
development of species; and “natural selection” (NS) which is the claimed mechanism of random
mutation and environmental selection that materialist Darwinians assert to be fundamental. He
gives the diagram shown in figure 5 with the caption:

Figure 5
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
55
A schematic representation of the standard neo-Darwinian model of evolution by natural
selection. The square on the left represents random genetic mutations, the arrow the
expression of those mutations as manifest traits (phenotypes), and the filters the action
of natural selection.32
Thus we see that ‘natural selection’ is supposed to function as a kind of environmental ‘sieve’
supposedly weeding out poor random mutations and allowing ‘advantageous’ adaptations to
survive.
Robert Owen, a British supporter of the Curvier ‘typological’ perspective (the notion that
organic ‘types’ are potential within a deeper layer of the process of reality), made the obvious
criticism that it is very unlikely that one tiny genetic change would produce an advantageous
new animal trait which conferred any advantage, it would take a vast number of them. This in
itself should indicate the unlikely nature of Darwin’s proposal. To take one ridiculous example
of the supposed transition of a hippo-like animal into a whale; the nose of a hippo is hardly likely
to become the blowhole of a whale due to one genetic mutation. In fact it is hard to imagine the
possibility of any sequence of random genetic changes causing such a movement, at the same
time as changing blood chemistry in order to allow a hippo-whale to dive to bone crushing
depths of the sea. The whole notion is childishly absurd, as absurd as the now discredited notion
that giraffes ‘evolved’ long necks because of stretching for acacia leaves.
The giraffe is an excellent example of the absurdity of the neo- or ultra- Darwinian worldview.
The biologists Davis and Kenyon summarize some of the crucial points of a giraffe’s remarkable
physiology as follows:
When standing upright, its blood pressure must be extremely high to force blood up its
long neck; this in turn requires a very strong heart. But when the giraffe lowers its head
to eat or drink, the blood rushes down and could produce such high pressure in the head
that the blood vessels would burst. To counter this effect, the giraffe is equipped with a
coordinated system of blood pressure controls. Pressure sensors along the neck’s
arteries monitor the blood pressure and activate contraction of the artery walls (along
with other mechanisms) to counter the increase in pressure.33

Such intricate details were not known about in Darwin’s day, the giraffe’s physiology is
extraordinarily fine-tuned in order that its head does not explode. Furthermore, there is no fossil
evidence of its supposed evolution. The researcher Wolf-Ekkehard Lönnig, an expert on mutation
genetics, a researcher in the field for over thirty years, has published a long carefully researched
paper entitled ‘The Evolution of the Long-Necked Giraffe – What Do We Really Know’ which
concludes:
If, however, the general lineages for almost all modern groups of vertebrates are as
uncertain as in the case of giraffes, then we are dealing with only suggestive
evolutionary interpretations in most other groups as well, yet without solid scientific
proof.34
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
56
Baron Georges Cuvier Robert Owen
In this paper he demonstrates the lack of fossil record and the impossibility of the complexly
coordinated giraffe physiology being the result of gradual random changes. The coordination
required in order to keep its head intact is far too intricate and ‘irreducibly complex’. As
Goswami says of the Darwinian account of the evolution of the giraffe, it is “too simplistic” (and
that is putting it mildly):
Longer neck vertebrae require many concurrent modifications. As the vertebrae become
longer, the head must become smaller, because it becomes more difficult to support the
head atop a long neck. The circulatory system has to produce higher blood pressure,
valves must originate to prevent overpressure when the giraffe stoops to get a drink.
The lung size has to increase so the animal can breathe through a much longer pipe.
Additionally, many muscles, tendons, and bones have to change harmoniously; in fact,
the entire skeletal frame has to be restructured to accommodate lengthened forelegs. It
goes on and on. Clearly, much more than neck-lengthening gene mutation have to be
involved – and with what amazing coordination! All this through cumulative step-bystep chance and necessity? It’s simply not credible.35
To be quite honest when one examines all the evidence available today, materialist Darwinism
(Neo-Darwinism or ‘Ultra-Darwinism’ as Simon Conway Morris calls it) is just stupid. There is
no other word to use, for example, for the notion that a random mutation in a giraffe might
extend the neck a little and randomly put in a pressure valve in anticipation of future random
extensions, random mutations creating further pressure valves and eventually a more powerful
heart and so on.
Steven Jay Gould famously called many Darwinian accounts “just-so stories.” And yet
materialist Darwinism is consistently promoted and defended with pugilistic fervour. Why?
According to Le Fanu:
The imperative to believe in the principle of evolution by natural law more than
outweighed its obvious deficiencies: ‘We accept [the theory of natural selection] not
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
57
because we are able to demonstrate the process in detail, nor because we can with more
or less ease imagine it’, observed … the zoologist August Weismann, ‘but simply
because we must, because it is the only possible explanation that we can conceive’.36
This can be compared with a more recent statement by Lewontin that scientists have “have a
prior commitment, a commitment to materialism.”37
It is clearly apparent that amongst committed materialists it is accepted that ‘science’ must
ignore any evidence which threatens their worldview precisely because they believe any other
worldview must be ‘supernatural’. But where is the science in such a view? A non-theistic
quantum psycho-metaphysical intelligent design perspective, such as Mensky’s for example,
considers that the internal intelligence is entirely natural.
As Le Fanu points out, the end point of this dogmatic adherence to a materialist worldview is the
complete devaluation of the human realm of awareness, culture and qualitative experience in
general. In a materialist Darwinian metaphysical worldview all qualitative aspects of existence
become devalued because they are asserted to be ultimately and ontologically unreal. This
becomes clear in some of the more extreme and silly claims of Dawkins, wherein he asserts his
view that ‘genes’ are the only entities which have ultimate ontological validity:
Now they [the genes] swarm in huge colonies. Safe inside gigantic lumbering robots
[ourselves] sealed off from the outside world, communicating with it by tortuous
indirect routes, manipulating it by remote control. They are in you and in me; they
created us, body and mind; and their preservation is the ultimate rationale for our
existence. They have come a long way, those replicators. Now they go by the name
of genes, and we are their survival machines.38
As Le Fanu rightly points out:
Most people might reasonably suppose this to be some sort of playful joke, perhaps
an ad absurdum argument to expose the folly of an exclusively materialistic view of
man. But it is not, and nor is it just Professor Dawkins – for this represents
mainstream conventional evolutionary thinking, taught in schools and universities,
expounded in textbooks and popular science, the focus of numerous academic papers
every year.39
And the assumed ontological primacy of the gene was extended, within the field of sociobiology,
to aspects of qualitative experience and behaviour such as altruism, love, consciousness and
awareness and the religious impulse. The problem with such sociobiological notions is the fact
that there is absolutely no evidence for any of them, it’s all speculative academic posturing and
implausible story-telling in pursuit of ego-enhancement and academic advancement.
But it is not just sociobiology that lacks evidence and plausibility. The entire materialist account
of Darwinian evolution also lacks evidence and plausibility. The claimed fossil evidence is
sketchy and concocted. Fossils which appear as if they can be in a sequence are appealed to as
being a direct material level evolutionary sequence. However, if the ultimate source of organic
structure resides at quantum levels then such resemblances are likely to be due to deeper
quantum processes rather than material level direct random mutation and natural selection. As
Lönnig points out in his paper on the Giraffe “already in Darwin’s day Galton warned of such
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
58
erroneous constructions when he pointed out, for example, that fire-arms and chinaware can be
ordered in a continuous series, and that it is necessary to take care in dealing with the same
phenomenon in biology.” Figure 6 illustrates:

Figure 6
Derivation of the fork from the knife, through the spoon, and the special evolution of
the soup ladle from the cake slicer. One may note especially the stepwise perfection in
the fork development from the 2-pronged meat fork (D) through the 3-pronged kitchen
fork (E) to the 4-pronged dining fork (F). The salad server is the intermediate link
between spoon (B) and meat fork (D) (mosaic evolution!). One only needs to assume
that everything is derived from primitive knives.40
Thinking that there is an evolutionary development sequence underlying tableware of course
would only be possible in the absence of significant information, i.e. they are designed by human
beings in order to prepare food and eat.
Such is the depth of intellectual incompetence in materialist-Darwinian academic discourse that
such idiotic oversights are regularly advanced as support for the Darwinian worldview. One
particularly stupid example was concocted by Professor Tim Berra (this is so stupid it is almost
impossible to believe the guy is actually a professor) in his book Evolution and the Myth of
Creationism (figure 7):
…if you compare a 1953 and a 1954 Corvette, side by side, then a 1954 and a 1955
model, and so on, the descent with modification is overwhelmingly obvious. … the
evidence is so solid and comprehensive that it cannot be denied by reasonable people.41
In his book Defeating Darwinism by Opening Minds Phillip E. Johnson writes concerning this:
Of course, every one of those Corvettes was designed by engineers. The Corvette
sequence — like the sequence of Beethoven’s symphonies to the opinions of the United
States Supreme Court — does not illustrate naturalistic evolution at all. It illustrates how
intelligent designers will typically achieve their purposes by adding variations to a basic
design plan. Above all, such sequences have no tendency whatever to support the claim
that there is no need for a Creator, since blind natural forces can do the creating. On the
contrary, they show that what biologists present as proof of “evolution” or “common
ancestry” is just as likely to be evidence of common design.42
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
59

Figure 7
Such concerns also apply to the fossil record, it could perhaps have been the result of materialist
evolution, although the mechanism proposed is highly implausible, but it could also have been
produced by a creative force acting on quantum potentiality. The most recent evidence indicates
the latter.
A lack of significant information contributed to the mistake that Darwin made. He thought that
the world was ultimately comprised of ‘matter’ and that mechanical type explanations were the
most appropriate for the phenomena he wanted to explain. However, as the philosopher of
science Thomas Kuhn has pointed out:
The similarity of forms was explained by evolution, and evolution in turn was proven
by the grades of similarities. That here one has fallen victim to circular reasoning was
hardly noticed; the very point that one set out to prove, namely that similarity was based
on evolution, was simply assumed, and then the different degrees in the gradation of the
(typical) similarities, were used as evidence for the truth of the idea of evolution. Albert
Fleischmann has repeatedly pointed out the lack of logic in the above thought process.
The same idea, according to him, was used interchangeably as assertion and as
evidence. However, similarity can also be the result of a plan, and morphologists such
as Louis Agassiz, one of the greatest morphologists that ever lived, attributed the
similarity of forms of organisms to a creation plan, not to evolution.43

DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
60
According to the invertebrate paleontologist and translator of some of Agassiz’s works, Paul J.
Morris, Agassiz was:
One of the great scientists of his day, and one of the “founding fathers” of the modern
American scientific tradition, Louis Agassiz remains something of a historical enigma. A
great systematist and paleontologist, a renowned teacher and tireless promoter of science
in America, he was also a lifelong opponent of Darwin’s theory of evolution. Yet even
his most critical attacks on evolution have provided evolutionary biologists with
insights.44

Louis Agassiz

Charles Darwin
Agassiz was entirely opposed to Darwin’s proposals for some very good reasons which have now
been validated by the Evo-Devo (evolutionary-developmental biology) revolution which has
shown that there are common pre-formed deep morphogenetic templates underlying all organic
forms. In his important work on the Evo-Devo worldview, Endless Forms Most Beautiful, the
evolutionary biologist Sean B. Carroll writes that:
The first shots in the Evo Devo revolution revealed that despite their great differences
in appearance and physiology, all complex animals — flies and flycatchers, dinosaurs
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
61
and trilobites, butterflies and zebras and humans — share a common “tool kit” of
“master” genes that govern the formation and patterning of their bodies and body parts.
… [This] discovery shattered our previous notions of animal relationships and of what
made animals different, and opened up a whole new way of looking at evolution.45
The Evo-Devo revolution actually indicates that there are deep pre-formed morphogenetic
‘template’ potentiality structures underlying all organic forms and it indicates that Darwin got it
wrong, and pre-Darwinian biologists such as Georges Cuvier, Richard Owen and Agassiz, who
perceived layers of hidden structural form underlying the variety of organic forms, were closer to
the truth. Richard Owen considered that the similarities and common structure underlying
animal forms were due to a deep layer of ‘archetypal’ patterning:
One of Owen’s most notable accomplishments was his description of the vertebrate
archetype. There he provided a theoretical framework to interpret anatomical and
physiological similarities shared among organisms. Owen saw these mutual features as
manifestations of a common blueprint. He defined the archetype this way: “that ideal
original or fundamental pattern on which a natural group of animals or system of
organs has been constructed, and to modifications of which the various forms of such
animals or organs may be referred.”46

However, despite the fact that the Evo-Devo revolution clearly undermines any Darwinian
perspective, few biologists seem to have the integrity to face up to the fact that Darwin got it
wrong, preferring instead to pretend that Evo-Devo is merely an extension of the Darwinian
viewpoint.
Figure 8. Richard Owen’s derivation of animal structures from an archetype (upper right)
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
62
Agassiz was a staunch creationist who saw a Divine Plan everywhere in nature, and he could not
reconcile himself to a theory that did not invoke design. He defined a species as “a thought of
God.” Thus he wrote in his Essay on Classification:
The combination in time and space of all these thoughtful conceptions exhibits not only
thought, it shows also premeditation, power, wisdom, greatness, prescience,
omniscience, providence. In one word, all these facts in their natural connection
proclaim aloud the One God, whom man may know, adore, and love; and Natural
History must in good time become the analysis of the thoughts of the Creator of the
Universe …47
.
However, we do not need to invoke a fundamentalist notion of God to see that that quantum
psycho-metaphysical insights and the Evo-Devo revolution have clearly indicated a vast and
intricate ‘plan’ written into the quantum ground of the process of reality. All organic forms are
patterned by potentialities within the quantum realm of potentiality-possibility.
There are other serious problems with materialist Darwinism. No one has ever witnessed or
demonstrated one species turning into another. The examples often given by Darwinian
supporters, Darwin’s Finches and Peppered Moths, are examples of variations within a species,
not a transformation from one species into another. The geographical evidence, again, can have
alternative explanations. The claimed Darwinian gradualism is refuted by the fact that the fossil
evidence clearly indicates the sudden emergence of multiple phyla such as occurred in the
Cambrian Explosion (542 million years ago), in which all the basic body plans of the major
phyla spontaneously appeared in a relatively short evolutionary time period. The paleontologist
Stephen J. Gould said of the fossils of the Cambrian Explosion:
The Cambrian explosion is the key event in the history of multi-cellular animal life. The
more we study the episode, the more we are impressed by its uniqueness and of its
determining effect on the subsequent pattern of life’s history. These basic anatomies that
arose during the Cambrian explosion have dominated life ever since, with no major
additions. The pattern of life’s history has followed from the origins and successes of
this great initiating episode.48
Furthermore, according to Gould:
Contrary to Darwin’s expectation that new data would reveal gradualistic continuity
with slow and steady expansion, all major discoveries of the past century have only
heightened the massiveness and geological abruptness of this formative event…
49
And he also concluded that:
The Cambrian explosion was the most remarkable and puzzling event in the history of
life.50
Paleontologist Simon Conway Morris is a specialist and expert in the Cambrian period who has
concluded:
The Cambrian explosion is real and its consequences set in motion a sea-change in
evolutionary history. Although the pattern of evolution is clearer, the underlying
processes still remain surprisingly elusive.51
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
63
However, if we understand that evolution takes place within quantum levels before manifesting
in the material realm such apparently sudden events wherein new organic forms come into being
apparently all at once become comprehensible.
Amit Goswami, in his excellent book Creative Evolution, calls the way in which evolving
morphogenetic structures develop within quantum levels of possibility a ‘tangled hierarchy’;
and according to Goswami the evidence of Wheeler’s quantum ‘delayed choice experiment’,
wherein a quantum superposition can be ‘collapsed’ backwards in time, shows that this process
can operate backwards in time. Goswami points out:
The lesson of the delayed choice experiment is profound. It solves the measurement
problem for quantum cosmology — how the universe of possibility can be actualized
even though no sentient being was present to observe the big bang. The universe
remains in a superposition of baby universes that evolves in possibility until, in one of
the possible universes, the possibility of sentience arises. The quantum consciousness
… collapses the possibilities and the evolved first sentient being observes itself as
separate from its environment, where upon simultaneously the universe manifests
retroactively, going backward in time from the moment of collapse all the way to the
big bang.52
This is close to the H&M account, wherein consciousness collapses quantum potentialities
backwards in time. And this mechanism can be applied to the Cambrian Explosion, which has
been called a biological ‘Big Bang’. Goswami writes that:
…quantum physics demands that biologists give up their materialist prejudice and base
biology on the metaphysics of the primacy of consciousness. One of the most important
rewards of such a change of paradigm is no less an accomplishment than being able, for
the first time in biology, to clearly distinguish not only between the conscious and the
unconscious, but also between life and nonlife. So, yes, not only we humans but cats and
lizards and even one-celled organisms can collapse possibility waves into actual events
of experience. Incidentally, this distinction will make use of the … characteristic of
consciousness introduced above, the characteristic of self-reference.53
It is this Wheeler-type ability of consciousness to act upon quantum potentialities through
internal quantum ‘self-reference’ which unfolds the world of biological organisms in a ‘top
down’ manner, starting with the fundamental quantum field of potentiality which has an internal
aspect of primordial consciousness.
Thus, we see that Le Fanu’s intellectual attack upon crude materialism and dogmatic Darwinism,
which still has its fundamental assumptions and worldview stuck in the nineteenth century, is
entirely justified. Getfer’s claim that Le Fanu’s viewpoint is nothing other than concealed
religion lacks intellectual integrity. As Le Fanu replied to Gefter’s unwarranted assertions:
Ms Gefter’s supposition that there is a genre of science books written by creationists
‘disguising their true views’ is, I would suggest, a mirage invoked to condemn by
association those like myself who draw attention to the limits of science and its
exclusively materialist explanations and theories. I believe that the New Scientist should
do more to examine such ideas to promote the spirit of open and intellectual enquiry.54
Writers who use the intelligent design perspective to advance theistic worldviews, such as
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
64
William Dembski, actually do so quite openly and do not attempt to disguise their true views. Le
Fanu’s book on the other hand, as anyone who reads it with attention and integrity would
conclude, simply attempts to, as he says, “draw attention to the limits of science and its
exclusively materialist explanations and theories.” A similar view has been expressed by the
atheist philosopher Thomas Nagel in his book Mind and Cosmos: Why the Materialist NeoDarwinian Conception of Nature is Almost Certainly False:
Physico-chemical reductionism in biology is the orthodox view, and any resistance to it
is regarded as not only scientifically but politically incorrect. But for a long time I have
found the materialist account of how we and our fellow organisms came to exist hard to
believe, including the standard version of how the evolutionary process works. The
more details we learn about the chemical basis of life and the intricacy of the genetic
code, the more unbelievable the standard historical account becomes.55

In her New Scientist review of Le Fanu’s book Gefter concludes:
I am all for a good mystery, but there is an important difference between revelling in the
excitement of the unknown and turning away from knowledge because you simply
don’t like the facts.56

However, when one investigates “the facts” it turns out that it is Gefter who turns away “from
knowledge because [she] simply [doesn’t] like the facts.”
Gefter indicates that her father was to some degree interested in Zen Buddhism in his youth,
having read some books by Alan Watts such as This is It and The Way of Zen. According to
Amanda Gefter it was her father’s musings on Zen which led him to his notion of the ‘H-State’,
the fundamental and foundational state of homogeneity which he thought must underlie the
world of phenomena. In the opening pages of TEL the following remarks about “how you can
get something from nothing” by her father are recorded:
…what if you had a state that was infinite, unbounded, and perfectly the same
everywhere? … a ‘thing’ is defined by its boundaries. By what differentiates it from
something else. … The edges define the ‘thing’. But if you have a completely
homogeneous state with no edges, and it’s infinite so there’s nothing else to differentiate
it from … it would contain no thing, it would be nothing! … Usually people think that
to get to nothing, you have to remove everything. But if nothing is defined as an
infinite, unbounded homogeneous state, you don’t have to remove anything to get to it –
you just have to put everything into a specific configuration. … You take a blender to
the world – you blend up every object, every chair and table and fortune cookie in this
place, you blend it all until everything is just atoms and then you keep blending the
atoms until any remaining structure is gone, until everything in the universe looks
exactly the same, and this completely undifferentiated stuff is spread out infinitely
without bound. Everything will have disappeared into sameness. everything becomes
nothing. But in some sense it’s still everything, because everything you started with is
still in there. Nothing is just everything in a different configuration. … So to get a
universe, nothing must become something … they must be two different states of the
same underlying thing – the same underlying reality – it’s a state of infinite unbounded
homogeneity.57
Once again we find a strange misuse of language. As noted previously, a homogeneous state or
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
65
field, which must ultimately be a quantum field or set of quantum fields, which is “still
everything” and is “completely undifferentiated stuff … spread out infinitely without bound” is
not actually a “nothing!” We previously noted David Albert rightly criticised Lawrence Krauss
for his assertion that the universe creates itself from “nothing.” In an additional preface added to
the latest version of his book A Universe From Nothing Krauss has attempted to defend his
position:
Can we understand how absolute nothingness, without even the potential for anything
at all to exist, does not still reign supreme? Can one ever say anything other than the
fact that the nothing that became our something was part of “something”, in which the
potential for our existence, or any existence, was always implicit? In the book I take a
rather flippant attitude toward this convention, because I do not think that it adds
anything to the productive discussion … I discount this aspect of philosophy here
because I think it bypasses the really interesting and answerable physical questions
associated with the origin and evolution of our universe.58

Such a misguided “flippant” attitude to conceptual coherence indicates exactly why Steven
Hawking’s remarks concerning the irrelevance of philosophy are wrong. Speaking to a Google
Zeitgeist Conference Hawking claimed that:
…almost all of us must sometimes wonder: Why are we here? Where do we come from?
Traditionally, these are questions for philosophy, but philosophy is dead … Philosophers
have not kept up with modern developments in science. Particularly physics.59
However, a philosophical approach to the metaphysical conceptual systems developed by
physicists, and conceptual use in general is vital when physicists and others are so often
“flippant,” wayward, incoherent and slapdash with their use of concepts and terminology. At
some margin of his mind Krauss must be aware of his conceptual imprecision as in a question
and answer session included at the end of the book he admits:
Now, that state of no-stuff may not be “nothing” in a classical sense, but it is a
remarkable transformation nevertheless.60
It may be a “remarkable transformation,” but not as remarkable as an impossible transformation
from absolute nothingness into lots of things. Krauss is admitting to using the term “nothing”
in his own personal sense. This, however, is something that scientists and philosophers should
avoid, if, that is, they wish to avoid misleading their audience.
Speaking of everything emerging from ‘nothing’ or ‘nothingness’ completely ignores the
relevance of consciousness, a move, of course, acceptable to materialists. Stapp, however,
describes the ground quantum “H-state” as follows:
… given the empirical fact that consciousness eventually did appear, it would seem that
some seed of consciousness, or potentiality for consciousness, must have been there all
along. In this connection it is worth noting that, as Heisenberg emphasized, the
ontological character of the quantum state is like that of an Aristotelian “potentia”,
which Heisenberg described as an “objective tendency”. The quantum state represents a
collection of objective tendencies for various physically possible psycho-physical
events to actually happen. This notion of “an objective tendency,” as best I can
conceive it in this quantum context, is something like a contemplated possibility
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
66
coupled to an urge to raise this possibility into an actuality. So it would appear that
something like a primordial consciousness was present already at the birth of the
quantum mechanically conceived universe. Recognition or acceptance of this notion
leads, in a quantum world devoid of even the most rudimentary life forms, to the
ancient idea of a cosmic mind, and to the conception of the universe as more like a
conscious organism than like a robotic machine. Mentality becomes primordial, not in
the individual atoms, but rather at the level of an “over-mind”. The emergence of
conscious life forms would then become the creation, by this evolving psychophysical
structure, of tiny substructures similar to itself.61
In other words an “H-state” must contain both potentialities and primordial consciousness.
Furthermore, Stapp indicates that this ground state Mind-energy-potentiality operates in order to
create “tiny substructures similar to itself.” These, of course, are all the sentient beings within
the universe. Such a view, of course, reiterates Mensky’s assertion of a ‘Life Principle’
operating upon quantum potentialities.
Stapp and Mensky’s accounts stand in marked contrast to that of Amanda Gefter, one of the
advantages being that they are logically coherent! Gefter seems to propose that entirely nonconscious “frames of reference” somehow arise from the quantum realm of potentiality, then
these “frames of reference,” without a glimmer of consciousness, start “observing” an illusory
‘material’ world into existence, then this “observer-created” ‘material’ world starts, without
recourse to consciousness, materialistically-randomly evolving initially non-conscious organic
beings, which then magically produce consciousness. The notion, however, that observing
“frames of reference,” devoid of any aspect of consciousness or primordial awareness, observe
the universe into illusory existence before the emergence of consciousness, is beyond absurdity.
The correct perspective, as indicated by Mensky’s account and in accordance with Stapp’s
viewpoint, requires that non-differentiated primordial consciousness unfolds individuated
consciousnesses due to the operation of an internal “Life-Principle.” And, as Mensky, Stapp,
Goswami and others indicate, such a view is suggested by quantum discoveries.
Both Mensky’s and Stapp’s characterization of the fundamental ground state of the universe,
which places primordial consciousness as a fundamental aspect, corresponds more closely to a
Zen point of view than that of Amanda Gefter’s father. As the Zen master Huang Po declared:
This pure Mind, the source of everything, shines forever and on all with the brilliance
of its own perfection. But the people of the world do not awake to it, regarding only
that which sees, hears, feels and knows as mind. Blinded by their own sight, hearing,
feeling and knowing, they do not perceive the spiritual brilliance of the source
substance. If they would only eliminate all conceptual thought in a flash, that source
substance would manifest itself like the sun ascending through the void and
illuminating the whole universe without hindrance or bounds.62

DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
67
Huang Po
Another term for this “pure Mind” energy is “Buddhanature.” As Tulku Urgyen Rinpoche tells
us, the original pure, or nondual, Mind-energy of Buddhanature loses recognition of its own
infinite nature when it becomes involved in the manifestation of samsara, which is the dualistic
cycle of the repeated death and rebirth of sentient beings:
Buddhanature has lost track of itself and created samsara, but it is also Buddhanature,
recognising itself…63
Within the cycle of the repeated death and rebirth within samsara, then, sentient beings cycle for
vast time scales, taking various forms of embodiment dependent upon actions and intentions,
until, that is, a sentient being becomes enlightened and thereby the Mind-energy of the universe
recognises its own ‘empty’ self-luminous nature and becomes a buddha, an awakened or
enlightened being.
In the closing pages of her book Gefter tells us that her father gave her a transcript of a talk given
by the French astrophysicist Laurent Nottale at a conference at Oxford University on Buddhism
and Science (a conference that I attended). The title of the talk was ‘Relativity and Emptiness’.
‘Emptiness’ is the usual translation of the Sanskrit word shunyata, which is a Buddhist
metaphysical term for the ultimate nature of reality. One modern Buddhist teacher points out
that:
Unfortunately, the word ‘emptiness’, which is used to translate the Sanskrit term
shunyata, carries a connotation of a nothingness, or a void. Happily, there is a
wonderful definition in Tibetan that captures its true meaning: tak ché dang dralwa,
which translates as: ‘free from permanence and non-existence.’64
This is an important point. There is no school of Buddhism which asserts that the ultimate
nature of reality is an absolute ‘nothingness’.
The Madhyamaka, or Middle Way, school asserts that the ultimate nature of reality is neither
permanent nor non-existent, in fact according to this Buddhist school of metaphysics the ultimate
nature hovers between extremes of existence and non-existence in exactly the same way as a
quantum superposition. In other words, the ultimate nature, or shunyata, is a quantum
superposition of existence and non-existence. This means that all phenomena lack ‘intrinsic
existence’, they are empty of any permanent core of independent existence. They are not
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
68
substantial things, but neither are they absolute ‘nothings’. They are appearances from the void
of quantum emptiness-potentiality. “Form is emptiness, emptiness is form,” as the Heart Sutra
says. The root of the term shunyata is sunya, the zero point, the cosmic seed of emptiness which
is ‘swollen’ with potentiality. One meaning of sunya, which is the Indian origin of the concept
of zero, is ‘the swollen’, in the sense of an egg of potentiality which is about to burst into
manifestation.
One of the central doctrines of the Buddhist Madhyamaka is that of the “two truths” or “two
modes of reality” or “two modes of perception.” This doctrine divides the process of reality into
the spheres of the ‘seeming’, or ‘conventional’ or ‘relative’ and the ‘ultimate’:
Thus two kinds of world are seen:
The one of yogins and the one of common people.
Here, the world of common people
Is invalidated by the world of yogins.65
The ‘seeming’, ‘conventional’ or ‘relative’ mode of perception, which corresponds to the
‘classical’ realm of physics, is the way that the world of phenomena appears within the
experiential continuums of unenlightened sentient beings, whilst the ‘ultimate’ is the mode of
reality experienced by enlightened beings, ‘yogins’ and buddhas. Gefter’s father says of this
distinction:
You could say that the origin of the universe comes from a point, but it is infinite in
size…Homogeneity is ultimate reality. Patterns are conventional reality…Nothingness
cannot exist. It is unstable.66
Whilst he is correct that the Buddhist ultimate reality of emptiness can be identified with
quantum potentiality and that conventional reality consists of the patterned phenomena of the
manifested world, he is wrong in his use of the term “nothingness,” and he is incorrect in
thinking that it is instability which causes manifestation. Manifestation occurs because of an
internal cognitive ‘pressure’ of primordial consciousness:
Both faculties and objects arise from the mind.
The manifestation of sensory objects and faculties
Is dependent upon an element that has been present
Throughout beginningless time.67

Furthermore, within the Buddhist psycho-metaphysical worldview this fundamental cognitive
pressure is ultimately in the direction of awakening and enlightenment. As Master Hsing Yun
says:
A buddha is a human being who has realised that he is a buddha; a human being is a
buddha who has not yet realised that he is one.68
And this, of course, means that “observers” eventually become buddhas, embodying the most
profound type of observership possible, a direct experiential observation of the ultimate nature of
the universe.
One appreciative reader sums up the metaphysical implications of Gefter’s book as follows:
Throughout her book, Gefter asks “If observers create reality, where do the observers
come from?” The answer is they come from the nothingness itself. Everything is
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
69
ultimately nothing. The nature of that nothingness in its primordial, undifferentiated,
unbounded state is pure consciousness, and so everything is ultimately consciousness.
Consciousness in its differentiated, bounded state is the observer present at the center of
its own world. … Gefter tells us that “Nothing is ultimately real”, which is exactly the
same as to say “Ultimately, only consciousness is real.” There is no contradiction, since
the true nature of consciousness in its undifferentiated, unbounded state is the very
nothingness that she acknowledges to be ultimate reality. Even the observer present at
the center of its own world is not ultimately real, since the observer is consciousness in
its differentiated, bounded state. … This explanation resonates deeply with the wisdom
of nondual metaphysics.69
But, whereas Jim Kowall draws the necessary conclusion that primordial consciousness is a
primary agency within the ground of the process of reality, Gefter, as we have seen, consistently
denies this necessary conclusion and supports an incoherent materialist diatribe against any kind
of spiritual implications of modern quantum discoveries. However, when we peel away the
layers of her delusion it becomes apparent that, as the eighth century Buddhist practitionerphilosopher Shantarakshita wrote:
All causes and effects
Are consciousness alone.
And all … abides in consciousness.
On the basis of the Mind Alone,
We should know that outer things do not exist.
… [and]
We should know that mind is utterly ‘empty’.70

1
Mensky, Michael: ‘Reality in quantum mechanics, Extended Everett Concept, and Consciousness’, 11
2
http://social-epistemology.com/2014/03/22/a-conversation-with-henry-stapp-ryan-cochrane/
3
http://www.kabbalah.info/engkab/kabbalah-worldwide/interview-with-amit-goswami#.U_x1NWNad9U
4
http://discovermagazine.com/2013/nov/14-defense-free-will
5 Kyabje Kalu Rinpoche (1993)
6
Stapp, Henry (2007)
7 Hawking, Stephen & Mlodinow, Leonard (2010), 155
8
http://mccabism.blogspot.co.uk/2009/04/quantum-theology-and-quantum.html
9
http://mccabism.blogspot.co.uk/2011/06/quantum-mechanics-and-consciousness.html
10 Scharf, D., Pseudoscience and Victor Stenger’s Quantum Gods, 4 —
http://www.truthabouttm.org/truth/SocietalEffects/Critics-Rebuttals/StengerRebuttal/index.cfm
11 Scharf, D., Pseudoscience and Victor Stenger’s Quantum Gods, 4 —
http://www.truthabouttm.org/truth/SocietalEffects/Critics-Rebuttals/StengerRebuttal/index.cfm
12 Scharf, 6-7
13 Scharf, 12
14 Stenger, Victor J. (2009), 127
15 Scharf, 13
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
70

16 Greene, Brian (2004), 81
17 Susskind, Leonard (2015), xii
18 Scharf, 19
19 Scharf, 26
20 http://www.newscientist.com/article/mg20126975.800-how-to-spot-a-hidden-religiousagenda.html?full=true#.U_yTAGNad9V
21 Le Fanu, James (2009), 22
22 Randall, L. (2006) 158
23 Vedral, Vlatko (2010), 211
24 http://www.nytimes.com/2012/03/25/books/review/a-universe-from-nothing-by-lawrence-mkrauss.html
25 Woolfson, Adrian (2000), 74
26 Barrow, D. John & Tipler, Frank J. (1986) p105
27 Woolfson, Adrian (2000), 83
28 Woolfson, Adrian (2000), 76
29 http://www.i-sis.org.uk/Nonrandom_directed_mutations_confirmed.php
30 Le Fanu, James (2009), 74-5
31 Fodor, Jerry – ‘Why Pigs Don’t Have Wings’, New York Review of Books –
http://www.lrb.co.uk/v29/n20/jerry-fodor/why-pigs-dont-have-wings
32 Fodor, Jerry & Piattelli-Palmarini, Massimo (2011), 23
33
Wolf-Ekkehard Lönnig (2006) ‘The Evolution of the Long-Necked Giraffe – What Do We Really
Know’ Part 1, 9
34
Wolf-Ekkehard Lönnig (2006) ‘The Evolution of the Long-Necked Giraffe – What Do We Really
Know’ Part 1, 21
35 Goswami, Amit (2008), 27
36 Le Fanu, James (2009), 104
37 http://www.nybooks.com/articles/archives/1997/jan/09/billions-and-billions-of-demons/
38
Dawkins, Richard (2006), 20
39
Le Fanu, James (2009), 165
40 Wolf-Ekkehard Lönnig (2006) ‘The Evolution of the Long-Necked Giraffe – What Do We Really Know’
Part 2, 11
41 Berra, Tim (1990), 117-119
42 Johnson, Phillip (1997), 63
43 Wolf-Ekkehard Lönnig (2006) ‘The Evolution of the Long-Necked Giraffe – What Do We Really Know’
Part 1, 20
44
http://www.ucmp.berkeley.edu/history/agassiz.html
45
Carroll, Sean B. (2006), 9
46 http://www.reasons.org/articles/archetype-or-ancestor-sir-richard-owen-and-the-case-for-design
47
http://www.ucmp.berkeley.edu/history/agassiz.html
48
S. J. Gould, Of Tongue Worms, Velvet Worms, and Water Bears, Natural History 104 (1995), 15.
49 Gould, Stephen J., Nature, vol. 377, October 1995, p.682.
50 Gould, Stephen J., “The Evolution of Life,” in Schopf, Evolution: Facts and Fallacies, 1999, 9
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 44-71
Smetham, G. P., Why Us: Trespassing on an Anthropic Lawn (Part II)
ISSN: 2159-046X DNA Decipher Journal
Published by QuantumDream, Inc.
www.dnadecipher.com
71

51
Conway Morris, S. The Cambrian “explosion”: Slow-fuse or megatonnage?
(http://www.pnas.org/content/97/9/4426.full)
52 Goswami, Amit (2008),119
53 Goswami, Amit (2008), 43
54 http://www.newscientist.com/article/mg20126975.800-how-to-spot-a-hidden-religiousagenda.html?full=true#.U_80VWNad9U
55 Nagel, Thomas (2012), 5
56 http://www.newscientist.com/article/dn16544-review-why-us-by-james-le-fanu.html#.U_8zdmNad9U
57 Gefter, Amanda (2014), 6-7
58 Krauss, Lawrence (2013), xvi — xvii
59 http://www.telegraph.co.uk/technology/google/8520033/Stephen-Hawking-tells-Google-philosophy-isdead.html
60 Krauss, Lawrence (2013), 205
61 http://www-physics.lbl.gov/~stapp/stappeditedversion.pdf
62 Addiss, Stephen; Lombardo, Stanley; Roitman, Judith (2008), 39
63 Schmidt, Marcia Binder (2002)
64 http://www.rigpawiki.org/index.php?title=Emptiness
65 Brunnhölzl, Karl (2004), 79
66 Gefter, Amanda (2014), 384
67 Thrangu Rinpoche, Kenchen (2001), 34
68 Hsing Yun, (Master) & Tom Graham (trans.) (2010), 120
69 Kowall, J. ‘The Physicist’s Dilemma: Ultimate Reality – The Non-Physical Nature of Consciousness’ —
Journal of Consciousness Exploration & Research | May 2014 | Volume 5 | Issue 4 | 392-396
70 Shantarakshita, Padmakara Translation Group (2005) 65-66 (I have altered the last line from “devoid of
self” to “empty”
(The End)
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 72-80 72
Pitk¨anen, M., On Magnetic Body, Bio-harmonies, Morphogenesis & Epigenetics
Exploration
On Magnetic Body, Bio-harmonies, Morphogenesis & Epigenetics
Matti Pitk¨anen 1
Abstract
In TGD, magnetic body is an intentional agent using biological body as a sensory receptor and
motor instrument. TGD also provides various mechanism used by magnetic body for control and
communication purposes, and the notion of bio-harmony suggests itself as a correlate for quantum
coherence at the level of basic bio-molecules. How magnetic body and bio-harmony could help to understand biology? Can one identify biological phenomena making these notions compelling? In this
article some candidates for phenomena of this kind are briefly discussed. The finding that behavioral
patterns of planaria can be remembered also by the piece of split planaria without brains is consistent
with the idea that replication of magnetic body coding for behaviors is behind biochemical replication. That alleles of the same gene have different expression could be understood if the bio-harmony
assignable to gene carries additional information besides the biochemical information. These notions
might help to understand the mechanisms epigenetic. Histone modification and DNA methylation are
believed to involve geometric locking preventing transcription. They could also affect the frequency
assignable to DNA codon or some key unit so that the resonance condition making possible reconnection of U-shaped flux tubes allowing biomolecules to get in contact and for transcription to proceed
fails to be satisfied. Epigenetic inheritance could reduce to inheritance of bio-harmony: the magnetic
bodies of cells of offspring get in tune with those of parent.
1 Introduction
What TGD can possibly give to biology is the vision about magnetic body [8] as an intentional agent
using biological body as a sensory receptor and motor instrument and about various mechanism used by
magnetic body for control and communication purposes. A new element is brought in by Zero Energy
Ontology: magnetic body is 4-dimensional and thus correlate for a behavioral pattern rather than 3-
D state for part of organism. Also the notion of bio-harmony [9] [7] suggests itself as a correlate for
quantum coherence at the level of basic bio-molecules. How magnetic body and bio-harmony could help
to understand biology? Can one identify biological phenomena making these notions compelling?
In this article some candidates for phenomena of this kind are briefly discussed. The finding that
behavioral patterns of planaria can be remembered also by the piece of split planaria without brains
is consistent with the idea that replication of magnetic body coding for behaviors is behind biochemical
replication. That alleles of the same gene have different expression could be understood if the bio-harmony
assignable to gene carries additional information besides the biochemical information.
These notions might also provide a fresh approach to epigenetics. Histone modification and DNA
methylation are believed to induce kind of geometric locking preventing transcription. They could also
affect the frequency assignable to DNA codon or some key unit so that the resonance condition making
possible reconnection of U-shaped flux tubes allowing biomolecules to get in contact fails and transcription
cannot proceed. Epigenetic inheritance could reduce to the inheritance of bio-harmony: the magnetic
bodies of cells of offspring get in tune with those of parent. To how high degree magnetic body and
bio-harmony are inherited? This becomes the key question.
1Correspondence: Matti Pitk¨anen http://tgdtheory.com/. Address: K¨oydenpunojankatu 2 D 11 10940, Hanko, Finland.
Email: matpitka@luukku.com.
ISBN: ISSN: 2159-046X DNA Decipher Journal www.www.dnadecipher.com
Published by QuantumDream, Inc.
DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 72-80 73
Pitk¨anen, M., On Magnetic Body, Bio-harmonies, Morphogenesis & Epigenetics
1.1 The notions of 4-D magnetic body and bio-harmony
Recall first some key ideas of TGD inspired quantum biology.

  1. In TGD framework magnetic body extends the pair formed by organism and environment to a
    kind of holy trinity. Magnetic flux tubes and the realization of genetic code in terms of dark
    proton sequences has been the key hypothesis. The model for cold fusion (see http://tgdtheory.
    fi/public_html/articles/cfagain.pdf) [?] suggests that also more general dark nuclei must be
    allowed. Dark neutron sequences could correspond to genes separated by dark protons. Dark weak
    interactions with large value of hef f effectively massless below neuron size scale would play central
    role and induce large parity breaking effects (chiral selection).
    The chemistry would not be all that matters. DNA-nuclear/cell membrane as topological quantum
    computer with braided magnetic flux tubes would explain why organisms with virtually identical
    genomes are so different (we and our ancestors for instance). The hierarchy of magnetic bodies
    would be responsible for the development of intelligence and for cultural evolution. Flux tubes
    connecting DNA and mRNA as well as mRNA and tRNA molecules are present but it is difficult
    to say anything concrete.
  2. Ontogeny could be seen as a kind of editing process for the text defined by the DNA. Control of
    control of… is involved so that situation is very complex. Who performs the editing? Does DNA
    edit itself and is the editing process defining evolution of genome coded by genome? Or is the editing
    performed by Darwinian selection at cell level (see https://en.wikipedia.org/wiki/Cellular_
    differentiation)? Or is the magnetic body the editor using genome also as its tool as TGD
    would suggest? What is important that in TGD framework self-organization in 4-D sense implied
    by Zero Energy Ontology replaces ordinary self organization leading to asymptotic spatial patterns
    and select spatiotemporal patterns as asymptotic behavioral patterns defining various biological
    functions. The role of magnetic body is central in this process.
  3. Magnetic body contains cyclotron Bose-Einstein condensates and cyclotron frequencies determined
    by the strength of magnetic field would give for DNA and other biomolecules additional characteristics. In TGD based model for musical harmony DNA codons would correspond quite concretely
    to 3-chords but played using dark photons (also ordinary music represented as sounds could be
    transformed to dark photon music). If one accepts the icosahedral model of bio-harmonies predicting genetic code correctly, there would be 256 fundamental harmonies characterised by the allowed
    collection of 3-chords and they would add to the information carried by DNA molecules. I have
    constructed a program building random sequences of the allowed chords using the additional harmonic rule that two subsequent chords contain at least one common note and this music sounds
    rather harmonic (albeit boring in absence of any other elements!)
  4. Could one distinguish between different states/phases of DNAs, mRNAs, tRNAs, and amino acids
    in terms of harmony? Could their functioning depend on the harmony? With the inspiration
    coming from the connection of emotions and musical harmonies I have proposed that the harmony
    associated with a gene or organ could correlate with something analogous to an emotional state
    or mood — maybe micro-mood or microemotion could be the proper notion. Could amino-acids be
    happy, hilarious, melancholic, sad, depressed? Could one distinguish between different phases of
    DNA, RNA, tRNA, aminoacid collections characterized by the harmony in turn characterizing the
    of a cell, organelle, organ, or even organism? tRNA defines the map of the harmony associated with
    DNA codons to amino-acid harmony. Is the information about DNA codon and about corresponding
    3-chord represented at the level of magnetic body of amino-acid- that is as the 3-chord, which it
    represents, and realized as the rules telling with which tRNAs amino-acid can reconnect?
    In contrast to DNA codons, which represent local information, harmony could represent holistic
    information and characterize entire genes or their intronic portions.
    ISBN: ISSN: 2159-046X DNA Decipher Journal www.www.dnadecipher.com
    Published by QuantumDream, Inc.
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 72-80 74
    Pitk¨anen, M., On Magnetic Body, Bio-harmonies, Morphogenesis & Epigenetics
    1.2 Problem
    There is however a problem. DNA codons coding for the same amino-acid correspond to different 3-chords
    of harmony. One of these chords corresponds to amino-acid itself and the codons coding for amino-acid
    correspond to the orbit of this chord under subgroup of isometries of icosahedron moving the triangles of
    icosahedron along the orbit. This would apply also to mRNA and maybe also to tRNA. The chords at
    the orbit of amino-acid are isomorphic (intervals are same) and obtained as transposes of each other.
    The chords are isomorphic but not identical and this leads to the problem with resonance paradigm
    unless one gives up the idea that amino-acid corresponds to a unique DNA codon and assumes that there
    is analog of gauge invariance allowing to choose the preferred codon freely.
  5. The assumption about preferred DNA codon could be given up if one can choose the preferred DNA
    codon freely so that also the magnetic bodies of amino-acids are characterized by 3-chords and thus
    carry information about what DNA codon coded them. This is possible if one has the analog of
    fiber space structure with DNA codons coding for amino-acid defining the fiber and amino-acids
    defining the base. This fiber structure with discrete gauge invariance is strongly suggestive and I
    have proposed it for two decades ago but it seems that it poses strong conditions on the orbits of
    the subgroups of isometries of icosahedron.
    This condition is very restrictive. Simplifying somewhat: one considers 60 codons decomposing into
    20+20+20 codings and each group of 20 codons codes for amino-acids belonging to different groups.
    There are twenty of them. The 20 triangles of icosahedron correspond to 3 DNA codons each
    and each of them corresponds to one and only one amino-acid. One has 3 subgroups of isometries
    corresponding to 20+20+20 decomposition.
    Can one perform a global gauge transformations realized as isometries and moving triangles along
    the orbits of one of the 3 subgroups involved — say isometry g1 of G1? These transformations
    would move the entire orbits of 2 subgroups involved — call them G2 and G3. What happens to
    the chords of G2 and G3: is their character changed completely so that these harmonies would be
    destroyed? It seems that this cannot work. Should one replace G2 and G3 with their automorphs
    g1G2g
    −1
    1
    and g1G3g
    −1
    1
    . Does this make sense? 3-chords defining give orbit should be invariant
    under automorphisms of Gi? This does not seem to be a realistic condition.
  6. Could different automorphs correspond to different collections of chords physically just as global
    gauge transformations generate different physical situations? Isometries of groups Gi would therefore define physically different realizations of bio-harmonies such that for each of them only one of
    the DNA codons coding for given amino-acid could actually perform the coding. Ordinary genetic
    code with many-to-one correspondence would make sense in statistical sense only. If this is true, the
    cyclotron frequency 3-chord assignable to amino-acid depends on the DNA coding it and implies
    physical distinctions.
  7. One can consider also a third alternative. DNA codon with same 3-chord as coding for amino-acid
    is in special role in that only it can resonate with the amino-acid! Could DNA codons codons
    correspond to same cyclotron frequency triplet (magnetic fields) but different value of hef f so
    that one would have chord with respect to energy rather than frequency. Different values of hef f
    for DNA codons coding for the same amino-acid would scale their cyclotron frequencies to the
    same amino-acid frequency while keeping cyclotron energies invariant? Cyclotron energy ratios for
    codons correspond to rational valued ratios Ei/Ej = hef f (i)/hef f (j) = n(i)/n(j). Amino-acid
    would correspond to fixed hef f and this creates a problem: can DNA codon code for amino-acid
    with different value of hef f . This option does not look attractive.
    Second option looks the most plausible one. Of course, it is early to talk about a prediction: it might
    well be that I have mis-understood something.
    ISBN: ISSN: 2159-046X DNA Decipher Journal www.www.dnadecipher.com
    Published by QuantumDream, Inc.
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 72-80 75
    Pitk¨anen, M., On Magnetic Body, Bio-harmonies, Morphogenesis & Epigenetics
    2 How the notions of magnetic body and bio-harmony could
    help to understand inheritance
    Next more concrete ideas about magnetic body and bio-harmony in relation to epigenetics and inheritance
    will be developed.
    2.1 Questions about bio-harmony
    One can pose a lot of questions about bio-harmony.
  8. It is not necessary to assign any interpretation on the harmony. Just the harmony could be enough
    if it is forced to be same for DNA, corresponding mRNA, tRNA, and aminoacids. One can however
    make questions. Is the harmony inherited invariant and could it distinguish between different
    personality types about which we learned in old books of psychology? Or could the harmonies
    correlate with our own moods?
  9. Could differentiation selecting particular genes as expressed genes apply also to harmonies so that
    given gene would correspond only to a particular harmony and different copies of gene could correspond to different harmonies. Could this selection rely on the same mechanisms as ordinary
    differentiation realized in terms of epigenetic mechanisms and DNA editing? From the magnetic
    bodies of genes the harmony would be automatically transferred to the magnetic bodies of mRNA,
    tRNA and aminoacids since otherwise the transcription and translation do not work since magnetic
    bodies do not have common resonance frequencies and reconnection and resonant interaction is not
    possible.
  10. Does given harmony characterize given gene or the entire cell? All basic biomolecules associated with
    a gene would naturally correspond to the same harmony. If the rRNAs associated with ribosomes
    are in harmony mutually cellular harmony seems to be the only option. If ribosomes have their
    own harmonies, only certain ribosomes can translate given gene. This would bring in additional
    control tool. The most plausible picture is that the situation depends on what happens in the
    self-organization process. Some organs/organisms are more harmonious, others not so harmonious.
    Harmony need not be given fixed to remain the same: magnetic body can have motor actions
    changing the cyclotron frequencies. Moods could reflect the character of harmony at gene level.
  11. Does magnetic body control the differentiation by posing restrictions on gene expression or vice
    versa? The idea about magnetic body as intentional agent suggests that the first option is correct.
    There would be hierarchy of magnetic bodies with magnetic bodies at the higher level controlling
    bodies at the lower level. The value of Planck constant would label the hierarchy levels and also DNA
    codons would be characterized by ”intelligence quotient” defined by hef f /h. This would be nothing
    but the analog for the hierarchy of program modules and I have earlier considered the realization
    of this hierarchy (see http://tgdtheory.fi/public_html/articles/braidparse.pdf).
  12. The selection of harmony could take place and be analogous to cell differentiation. This would be a
    self-organization process in which magnetic bodies of genes, cells, etc.. tune themselves to resonance
    with each other by modifying their magnetic fields by controlling their thickness (for monopoles
    flux the flux is invariant). Something analogous to the development of social skills. This could pose
    resonance as a constraint on processes like replication, transcription, reverse transcription, silencing,
    enhancing, editing, etc…. It might induce the differentiation at gene level.
    Editing processes for genome could be seen as being induced by the motor actions of the magnetic
    body involving reconnection and change of the value of hef f changing the length of the flux tube
    and bringing biomolecules near to each other or separating them. This selection would also apply
    to the intronic part of DNA proposed to be responsible for topological quantum computation like
    ISBN: ISSN: 2159-046X DNA Decipher Journal www.www.dnadecipher.com
    Published by QuantumDream, Inc.
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 72-80 76
    Pitk¨anen, M., On Magnetic Body, Bio-harmonies, Morphogenesis & Epigenetics
    processes. The copies of same fragment appearing in intronic portion and copies of genes could
    correspond to different harmonies.
    2.2 Can the notions of magnetic body and bio-harmony explain something
    that ordinary genetic cannot?
    It would be nice to identify some biological phenomenon difficult to understand in standard framework
    but having an elegant explanation in terms of magnetic body.
  13. The notion of harmony could manifest itself at the level of genes as different expressions for the
    copies of same gene if they correspond to different notions of harmony. The copies of gene are
    known as alleles (see https://en.wikipedia.org/wiki/Allele). The alleles can indeed give rise
    to different phenotypic traits such as different pigmentation.
  14. Morphogenesis provides examples of this kind of phenomena [2, 3, 4]. The first key idea is that DNA
    and cell replication is induced by the replication of magnetic bodies serving as information carriers
    (see http://tgdtheory.fi/public_html/tgdlian/tgdlian.html#lianPB) [8]. The second key
    idea is that in zero energy ontology (ZEO) magnetic body is 4-dimensional and represents behavioral
    patterns rather than only 3-dimensional patterns. For instance, memory as behavioral patterns can
    be inherited by the piece of planaria worm not containing the brain. The explanation could be that
    the magnetic body carries behavioral patterns replicated in the splitting of the worm.
  15. Epigenetics studies changes of gene expression not caused by the change of DNA itself. Epigenome
    (see https://en.wikipedia.org/wiki/Epigenome) is the highly dynamic part of DNA controlling
    expression of the rather stable part of genome. One might regard stable part of genome as hardware and epigenome as topological quantum computer programs assignable to magnetic body and
    modifying gene expression epigenetically. Comment sign in computer code serves as a computer
    scientific metaphor for epigenetic control by repression.
    The modelling of epigenesis in terms of magnetic body and bio-harmonies deserves a separate discussion.
  16. The modification of transcription rate is the basic tool of epigenetic regulation. There are two
    basic mechanisms involved. Histone modification (see https://en.wikipedia.org/wiki/Histone
    affects the histones of chromatin so that the transcription is repressed or activated. Histone modification takes place by several mechanisms. DNA methylation occurs for CpG pair and if it occurs for a
    promoter region it represses the transcription and serves as a kind of gene lock. The degree of methylation serves as a measure for the effectiveness of repression. I do not know whether the locking is absolute at the level of single gene or whether only the transcription rate is reduced. Two mechanisms
    are mentioned in the Wikipedia article (see https://en.wikipedia.org/wiki/DNA_methylation).
    Methylation can impede geometrically some step in the transcription. Methylated site can be also
    accompanied by proteins affecting histones in chromatin and in this manner impede transcription.
  17. The notions of magnetic body and bio-harmony suggest an alternative — one might even hope fundamental — mechanism of repression. Methylation (histone modification) could affect some cyclotron
    frequency associated with DNA codon (histone). In the optimal situation for transcription the DNA
    and protein catalyzing the transcription or mRNA are in resonance. When cyclotron resonance condition is not exactly satisfied, the reconnection rate for the U-shaped flux tubes associated with the
    molecules involved in the process is reduced and also transcription is repressed.
    I have considered also the radical possibility that the dynamics at the level of magnetic body
    is fundamental for biology and that magnetic body defines templates for the bio-molecular selforganization making dark matter dynamics visible. This is probably too extremist view and it
    ISBN: ISSN: 2159-046X DNA Decipher Journal www.www.dnadecipher.com
    Published by QuantumDream, Inc.
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 72-80 77
    Pitk¨anen, M., On Magnetic Body, Bio-harmonies, Morphogenesis & Epigenetics
    would seem that biochemistry affects the cyclotron frequencies assignable to the magnetic body by
    affecting the strengths of magnetic fields also at dark magnetic flux tubes.
  18. The notions of epigenetic code (see https://en.wikipedia.org/wiki/Epigenetic_code) and histone code (see https://en.wikipedia.org/wiki/Histone_code) have been proposed. Epigenetic
    code would consist of histone modifications and additional modifications such as DNA methylation. The codeword of the epigenetic code could code for some larger unit than protein: say gene
    or entire cell. The hypothesis is that the chromatin-DNA interactions are induced by histone tail
    modifications (such as methylation, acetylation, ADP-ribosylation, ubiquitination, citrullination,
    and phosphorylation). There are 4 histones and the position of modification varies as well as the
    modifier (the above modifications are not the only ones) so so that the number of modifications is
    very large.
    The addition of bioharmonies to the genetic information could simplify the situation dramatically
    since the modifications could be seen as defining of of the 256 bio-harmonies with 64 chords each
    (this for fixed scale which varies if the value of magnetic field strength is varied: biophoton spectrum
    in visible is proposed to represent the range of values of magnetic field). The most plausible starting
    hypothesis is that given harmony characterizes the gene. Much simpler option would be that the
    harmony characterizes entire cell or even group of cells.
    If the modification by kicking cyclotron frequency out of harmony is enough to repress transcription,
    almost endless number of bio-chemical manners to achieve would exist but the epigenetic code could
    be very simple at the basic level as TGD would predict. Each bio-harmony [?]harmonytheory [7]
    would provide a representation of genetic code in terms of 3-chords predicting correctly the DNAamino-acid correspondence (there are actually two slightly differing codes explaining the presence
    of 21st and 22nd amino-acid and deviations from the standard code). The states of dark protons
    (or neutrons) are also proposed to realize genetic code [6, 5]: it is an open question whether these
    codes imply each other as they should.
  19. The understanding of transgenerational epigenetic inheritance (see https://en.wikipedia.org/
    wiki/Transgenerational_epigenetic_inheritance) raises difficult challenges. One should understand how histone modification and DNA methylation are transferred to daughter cells in cellular
    division or inherited by the offspring. Transgenerational interaction of the genomes seems necessary.
    In TGD framework the interaction of magnetic bodies of via resonance mechanism could transfer
    the epigenetic programs to the offspring. Offspring could ”learn” the epigenetic programs of the
    mother by tuning.
  20. Gregory Carey (see http://www.colorado.edu/ibg/people/61) gives nice real life examples about
    the complexities of epigenesis identified quite generally as gene regulation (see http://tinyurl.
    com/zb97cgs). He compares the gene regulation involved with the handling of a stressful situation
    to ”nightmarish Rube Goldberg mousetrap” and sees the process as extremely ineffective from
    engineering point of view. For instance, the hormones secreted to blood circulation are distributed
    to the entire body. The whole thing could be carried out in brain! He also wonders why evolution
    is so inefficient. All cells have same genome although most of the genes are silenced. Second strand
    of DNA is totally un-used and most of DNA consists of introns. His explanation is that evolution
    does not make long term plans but finds just a solution to a particular without thinking it from a
    wider perspective: ”If it ain’t broke, don’t fix it”.
    I tend to see this differently. If entire body is coherent quantum entity, engineering based thinking
    does not make sense. Entire body and also magnetic body must be informed from the stress situation
    since the reaction is holistic. The genes which are not used for gene expression might be used for
    other purposes. Topological quantum computation could be this purpose in TGD framework and
    repressed genes could be thus used for quantum information processing. Information processing
    could be actually the dominating function of the DNA of higher vertebrates.
    ISBN: ISSN: 2159-046X DNA Decipher Journal www.www.dnadecipher.com
    Published by QuantumDream, Inc.
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 72-80 78
    Pitk¨anen, M., On Magnetic Body, Bio-harmonies, Morphogenesis & Epigenetics
    To sum up, magnetic body could be seen as the ”boss” controlling the gene expression and also the
    evolution of genome in longer scales. Magnetic body would use bio-molecular mechanisms for its purposes.
    This would bring in a new kind of inheritance: bio-harmony would be inherited. The most spectacular
    almost-prediction would be that genetic code is many-to-one only in statistical sense.
    2.3 RNA is transferred between soma cells and germ cells
    The basic question of epigenesis is how the information between soma cells and germ cells is transferred.
    In standard genetic the transfoer RNA or DNA molecules is necessary to achieve this. In TGD dark DNA,
    RNA, tRNA, and aminocids consisting of dark nucleons realized as nuclear strings and accompanied by the
    corresponding biomolecules is one possibility. The extremist view would be that the dynamics of the dark
    variants of basic bio-molecules induces the dynamics of their molecular shadows making them only visible.
    Also the transfer of information as cyclotron radiation can be considered in TGD framework and cyclotron
    resonance could serve as a fundamental mechanism of epigenetic control. The above model suggest that
    epigenetic control mechanisms rely on resonance mechanism for 3-chords associated with DNA codons
    and other biomolecules giving them names is also at work besides purely geometrical silencing.
    The popular article No Sex Required: Body Cells Transfer Genetic Info Directly Into Sperm Cells,
    Amazing Study Finds (see http://tinyurl.com/hhdth5j) summarizing the findings discussed in the
    article [1] (see Soma-to-Germline Transmission of RNA in Mice Xenografted with Human Tumour Cells:
    Possible Transport by Exosomes (see http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4081593/) as
    very interesting concerning this basic question.
    The abstract of the article gives for a professional a readable summary.
    Mendelian laws provide the universal founding paradigm for the mechanism of genetic inheritance
    through which characters are segregated and assorted. In recent years, however, parallel with the rapid
    growth of epigenetic studies, cases of inheritance deviating from Mendelian patterns have emerged. Growing studies underscore phenotypic variations and increased risk of pathologies that are transgenerationally
    inherited in a non-Mendelian fashion in the absence of any classically identifiable mutation or predisposing genetic lesion in the genome of individuals who develop the disease. Non-Mendelian inheritance
    is most often transmitted through the germline in consequence of primary events occurring in somatic
    cells, implying soma-to-germline transmission of information. While studies of sperm cells suggest that
    epigenetic variations can potentially underlie phenotypic alterations across generations, no instance of
    transmission of DNA- or RNA-mediated information from somatic to germ cells has been reported as yet.
    To address these issues, we have now generated a mouse model xenografted with human melanoma
    cells stably expressing EGFP-encoding plasmid. We find that EGFP RNA is released from the xenografted
    human cells into the bloodstream and eventually in spermatozoa of the mice. Tumor-released EGFP RNA
    is associated with an extracellular fraction processed for exosome purification and expressing exosomal
    markers, in all steps of the process, from the xenografted cancer cells to the spermatozoa of the recipient
    animals, strongly suggesting that exosomes are the carriers of a flow of information from somatic cells
    to gametes. Together, these results indicate that somatic RNA is transferred to sperm cells, which can
    therefore act as the final recipients of somatic cell-derived information.
    Some background is needed to understand this rather technical summary.
  21. Darwinism has dominated biology since Darwin. The rules of classical Mendelian inheritance conform with the Darwinian view and can be reduced to genetic level. Various traits are inherited
    genetically by sexual reproduction and genome would change during lifetime only through mutations. Genome changes exremely slowly by random changes for offspring from which selection
    pressures choose the survivors.
    Lamarckian view in turn assumed that the external circumstances experienced by organism leave
    a trace, which can be inherited but it could not be formulated in terms of modern molecular
    biology whereas the Darwinian dogma could be formulated in terms of Weissman’s genetic barrier.
    Information flows from germ cells to soma but never in opposite direction. If it would do so, the
    ISBN: ISSN: 2159-046X DNA Decipher Journal www.www.dnadecipher.com
    Published by QuantumDream, Inc.
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 72-80 79
    Pitk¨anen, M., On Magnetic Body, Bio-harmonies, Morphogenesis & Epigenetics
    soma interacting with environment could transfer information to germ cells and the experiences
    during lifetime could leave inheritable trace to germ cells.
    An analogous dogma is that information is always transcribed from DNA to RNA to proteins but
    never in opposite direction. It is now known that this takes place in case of viruses and retroviruses:
    there are so called jumping genes which can also make copies of themselves. 5 per cent of human
    genome conists of endogenous retroviruses capable of doing the same. The huge genome of maize
    is due to this kind of proces.
  22. The development epigenetics has started to shatter the belief on Wessimann’s genetic barrier. Gene
    expression is not fixed by genome alone and can be change even when genes are unaffected. Silencing
    of genes by DNA methylation and histone modification allow to modify gene expression. Silencing
    is essentially a locking of gene preventing its expression by transcription followed by translation.
    It is now known that epigenetic changes in the gene expression can be inherited. The mechanisms
    are still poorly understood. What seems however clear the genome is more like a slowly changing
    hardware and gene expression or whatever is behind it is the software and programs can change
    very rapidly by just adding or deleting comment signs in the code. A deeper understanding of this
    software is needed.
  23. Epigenetic inheritance requires that genetic information is transferred from soma cells to germ cells.
    If only DNA or RNA are capable of representing genetic information, then DNA or RNA must be
    transferred from soma cells to germ cells. No instance of direct DNA or RNA mediated information
    from soma to germ cells had been observed before the above mentioned experiments. One can
    of course challenge the assumption about DNA and RNA as the only representations of genetic
    information.
    The basic idea of the experiment was simple. Use a marker for RNA by using plasmids (DNA strands
    not belonging to chromosomes) genetically engineered to code for a marker protein making itself visible
    by fluoresence. Then one just follows the fate of these proteins generated in soma cells and looks whether
    they end up inside germ cells and how this happens.
    More technically: mouse model was xenografted with human melanoma cells stably expessing EGFPcoding plasmid (expressed in a manner possibly evoking emotions: human melanoma cancer tissue was
    implanted in mouse). EGFP-RNA is released from xenografted human cells to blood. One just looks
    whether it eventually ends up to the sperm cells of mice and tries to identify the transfer mechanism.
    Only transfer to sperm cells was studied. One might expect that the transfer of RNA can happen also to
    ovum. I guess that the sperm cells are easier to study.
    What was observed?
  24. The transfer of RNA from soma cells to sperm cells was indeed found to occur. The transferred
    RNA can in turn induce epigenetic effects in germ cells known to be inherited by a mechanisms,
    which however remain poorly understood. Epigenetic mechanisms seem to be involved in the cases
    considered so that DNA is not changed, only its expression.
  25. The transfer mechanism was identified. The transferred RNA is contained by exosomes analogous
    to synaptic vesicles transferring neurotransmitters from presynaptic to postsynaptic cell. Transfer
    of RNA takes place via fusion of the membranes just like transfer of neurotransmitters. Maybe
    genetic engineering using exosomes or analogous structures to transfer the needed material to cells
    has been tried.
    The implications of the findings are dramatic but already implied by the earlier work in epigenetics. What is important that Lamarckian view can be now defended by a concrete genetic mechanism.
    Lamarckism implies that the time scale of inheritance becomes the time scale for the appearence of a
    new generation. Nutrition, environment, lifestyle and even meditation and similar practices, are already
    ISBN: ISSN: 2159-046X DNA Decipher Journal www.www.dnadecipher.com
    Published by QuantumDream, Inc.
    DNA Decipher Journal | March 2016 | Volume 6 | Issue 1 | pp. 72-80 80
    Pitk¨anen, M., On Magnetic Body, Bio-harmonies, Morphogenesis & Epigenetics
    now known to affect gene expression on daily basis: we are not victims of genetic determinism and are
    epigenetically responsible for our own well-being. Epigenetic information can be transferred also to germ
    cells so that we responsible also for the well-being of our children. Our children suffer our sins and share
    our sufferings.
    The precise mechanism of inheritance of epigenetic modifications remains still poorly understood
    although it seems that the transfer or RNA to germ cells occurs. There are also other hints: it is known
    that alleles (variants of game gene) can express themselves differently. One allele can also induce other
    allele to express in the same manner. Somekind of ”social pressure” like interaction seems to be involved.
    As explained, TGD suggests the notion of magnetic body and cyclotron resonance as this interaction.
    The DNA of offspring get tuned to the DNA of mother during pregnancy and this gives to epigenetic
    inheritance. Various epigenetic mechanisms such as methylation and histone modification could affect
    cyclotron frequencies besides purely geometric modifications of DNA and locking at the level of gene
    could be accompanied kicking out of tune at the level of magnetic body. In this framework the transfer
    of RNA to germ cells would be necessary to affect the cyclotron frequencies.
    References
    [1] Cossetti C et al. Soma-to-Germline Transmission of RNA in Mice Xenografted with Human Tumour
    Cells: Possible Transport by Exosomes. Plos One.Available at: http://www.ncbi.nlm.nih.gov/
    pmc/articles/PMC4081593/ , 9, 2014.
    [2] Levin M. The wisdom of the body: future techniques and approaches to morphogenetic fields
    in regenerative medicine, developmental biology and cancer. Regen Med . Available at: http:
    //www.futuremedicine.com/doi/pdf/10.2217/rme.11.69, 6(6):667–673, 2011.
    [3] Levin M. Morphogenetic fields in embryogenesis, regeneration, and cancer: Non-local control of
    complex patterning. Biosystems. Available at: http://www.ncbi.nlm.nih.gov/pubmed/22542702,
    109(3):243–261, 2012.
    [4] Levin M Somrat T. An automated training paradigm reveals long-term memory in planarians and its
    persistence through head regeneration. The J Experimental Biology. Available at: http://tinyurl.
    com/ntlxpep, 216:3799–3810, 2013.
    [5] Pitk¨anen M. Homeopathy in Many-Sheeted Space-Time. In Bio-Systems as Conscious Holograms. Onlinebook. Available at: http://tgdtheory.fi/public_html/hologram/hologram.html#
    homeoc, 2006.
    [6] Pitk¨anen M. Nuclear String Hypothesis. In Hyper-finite Factors and Dark Matter Hierarchy. Onlinebook. Available at: http://tgdtheory.fi/public_html/neuplanck/neuplanck.html#
    nuclstring, 2006.
    [7] Pitk¨anen M. Quantum Model for Hearing. In TGD and EEG. Onlinebook. Available at: http:
    //tgdtheory.fi/public_html/tgdeeg/tgdeeg/tgdeeg.html#hearing, 2006.
    [8] Pitk¨anen M. Quantum Mind, Magnetic Body, and Biological Body. In TGD based view about living
    matter and remote mental interactions. Onlinebook. Available at: http://tgdtheory.fi/public_
    html/tgdlian/tgdlian.html#lianPB, 2012.
    [9] Pitk¨anen M. Geometric theory of harmony. Available at: http://tgdt
Translate »